microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice
microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice
... novel endogenous protectant against beta amyloid (1-42)-induced cognitive impairments in mice Ngo Thi Ngoc Yen Department of Pharmacy Graduate School, Kangwon National University Abstract Microsomal ... dementia. Choline acetyltransferase and glutamic acid decarboxylase activities in necropsy brain tissue Reeta, K.H.; Mehla, J.; Gupta, Y.K. Curcumin is protective against phenytoin-induced cognitive ... A (42-1) mEH (+/+) mEH (-/-) A (1-42) * Thesis for the Degree of Master Microsomal epoxide hydrolase gene is a novel endogenous protectant against beta amyloid (1-42)-induced...
- 54
- 168
- 0
Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt
... shRNA knockdownThe HepG2 human liver carcinoma cell line, MIA PaCa-2human pancreatic carcinoma cell line and the human ade-nocarcinoma colorectal cell lines DLD1, T84 and Colo205were all obtained ... sequence in rat, mouse and humanCUX1 was kindly provided by Dr Julian Downward [50].Two bases (in capitals) were further mutated (5¢-aagaagaacaGAccagaggattt-3¢) to be used as a control. The Caco-2 ... hB2MIC227dw, 5¢-tcaatgtcggatggatgaaa-3¢.AcknowledgementsWe thank Dr Peter G. Traber for the generous gift ofthe microarray data analysis that was originally per-formed at the Penn Microarray Facility...
- 13
- 359
- 0
Báo cáo khoa học: Characterization and cDNA cloning of a clofibrate-inducible microsomal epoxide hydrolase in Drosophila melanogaster potx
... from mammals and insects in order to iso-latethegene.The1597bpputativecDNAofD. melano-gaster microsomal EH (DmEH) obtained from a larvalcDNA library encoded 463 amino acids in an open readingframe. ... DIG Labelling Mix (Roche). Toprepare a DmEH probe, primers (5¢-ATGGCGAACATCTGGCCACGAATC-3¢ and 5¢-TTATGAGAAATTGGCTTTCTGGAC-3¢) were used, and to prepare Actin5C probe as an internal marker, ... Ottea, J .A. , Harshman, L.G. & Hammock, B. (1987) Pattern of epoxide metabolism by epoxide hydrolase and glutathioneS-transeferase associated with age and genotype in Drosophilamelanogaster....
- 10
- 378
- 0
Báo cáo khoa học: S -Stereoselective piperazine-2-tert-butylcarboxamide hydrolase from Pseudomonas azotoformans IAM 1603 is a novel L-amino acid amidase doc
... sequenceranging from 1632 to 1654. The two primers were asfollows: sense primer, 5¢-CGATCCAAGCTTTAAGGAGGAAtagGAAATGGAATTCATCGAAAAAATCCG-3¢antisense primer, 5¢-TGCATCCATCTAGAGCATTCAGC-3¢. The amplified ... MolecularCloning: a Laboratory Manual, 2nd edn. Cold Spring HarborLaboratory, Cold Spring Harbor N.Y.22. Misawa, N., Nakagawa, M., Kobayashi, K., Yamano, S., Izawa,Y., Nakamura, K. & Harashima, K. ... Y., Sato, S., Minamisawa, K., Uchiumi,T., Sasamoto, S., Watanabe, A. , Idesawa, K., Iriguchi, M.,Kawashima, K., Kohara, M., Matsumoto, M., Shimpo, S.,Tsuruoka,H.,Wada,T.,Yamada,M.&Tabata,S.(2002)Complete...
- 11
- 283
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... spinal cord tissue sections were treated with an antibody against Vgf (rabbit anti rat monoclonal D20, 1:1000, Santa Cruz, CA) or against SMI-32 (rabbit polyclonal, 1:200 dilution; Santa ... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N. Peptidomic ... casein. Samples and standards were applied in duplicate and incubated overnight at 4°C. Following the Vgf capture phase, the plates were reacted with rabbit anti-Vgf antibody (#9130 against...
- 8
- 499
- 0
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc
... Ac-DEVD-AMC is a substrate for caspases 3and 7; Ac-YVAD-AMC is a substrate for caspase 1;Ac-IETD-AMC is a substrate for caspase 8 and 10;Ac-LEHD-AMC is a substrate for caspases 2, 4, 5 and 9.Ac-DVPD-AMC, ... apoptosis is induced. In contrast, cleavageof the p27KIP1DPSD-AMC substrate remained constantunder these assay conditions.Thus it appears that KIPase maintains a basal level ofp27KIP1cleavage ... Hueber ,A. O.,Zornig,M.,Bernard ,A. M.,Chautan,M.&Evan,G. (2000) A dominant negative Fas-associated death domainprotein mutant inhibits proliferation and leads to impaired cal-cium mobilization in...
- 8
- 442
- 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... homologs are poly (A) polymerases. Proc Natl Acad Sci USA 101, 4407–4412.18 Nakanishi T, Kubota H, Ishibashi N, Kumagai S,Watanabe H, Yamashita M, Kashiwabara S, Miyado K& Baba T (2006) ... glycine-rich(RGG) motifs that are characteristic of RNA-bindingproteins, and an alanine-rich carboxy-terminal sequencethat could be involved in protein–protein interactions.Interestingly, this ... the enhancing effect of splicing onmRNA translation [34–36]. Rbm9, as a splicing factorinteracting with a PAP, may also participate in thetranslational enhancement mediated by introns.Indeed,...
- 14
- 502
- 0
Báo cáo khóa học: SUT2 is a novel multicopy suppressor of low activity of the cAMP/protein kinase A pathway in yeast docx
... amplified from plasmid pUG27 asdescribed above using the primers disRAS1fwd5¢-TTCACGATTGAACAGGTAAACAAAATTTTCCCTTTTTAGAACGACATGCAGCTGAAGCTTCGTACGC-3¢ and disRAS1rev CAAAACCATGTCATATCAAGAGAGCAGGATCATTTTCAACAAATTATGCATAGGCCACTAGGGATCTG-3¢. ... plasmid pUG27 [13] using the primersdisSUT2fwd 5¢-TGACGCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGATATGAAGGCATAGGCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TATTAATATTCCTATATTTTACATAGGAGGAAATTACATGCATGAAACCTACAGCTGAAGCTTCGTACGC-3¢, ... http://mips.gsf.de/proj/yeast/info/tools/hegemann/gfp.html) using the primersSUT-GFPfwd 5¢-GACTGTCGATGATTATGGTTGCCCGCTGGCTTCCAAACCCTTATCGATACCGTCGACCC-3¢ and SUT-GFPrev 5¢-AACAATTTCACACACAGGAAACAGCTATGACCATGATTACGCTATAGGGCGAATTGGGTA-3¢,...
- 8
- 485
- 0
Báo cáo khoa học: hhLIM is a novel F-actin binding protein involved in actin cytoskeleton remodeling ppt
... transvacuolar strands and maintain overallcellular architecture. As mentioned above, CRP1 mayparticipate in the formation and ⁄ or maintenance oflong actin cables [12]. Consistent with this ... [17]. FHL3 reg-ulates a- actinin-mediated actin bundling as an actin-binding protein [18]. CRP3 (also called muscle LIMprotein–MLP) plays an important role in myogenesisand in the promotion ... replacing cysteine with serine in domain 2, and resultsshowed that the second LIM domain plays a central role in bundling ofF-actin. Taken together, these data identify hhLIM as an actin-bindingprotein...
- 11
- 347
- 0
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CACGCAGCTCATTGTAGAAGG-3¢. Another primer pairused for SerpinA3 was ACTas5-ACTas3: 5¢-GAATCCACCAGCTACATCCA-3¢ and 5¢-GTGCCCTCCTCAAATACATCA-3¢.Western blot assayThe cells ... pcDNA3.1-GST-Nur77plasmid. pSilencer-shNur77 was prepared by overlappingstrategy with primers 5¢-gacGGATCCgcagtccagccatgctcctttcaagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATCGATccaaaaaacagtccagccatgctccttctcttg-3¢ ... primer pair for Serpin- A3 was ACT5-ACT3: 5¢-GACTCGCAGACAATGATGGTC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢. Theresults were normalized with b-actin, for which the primerswere 5¢-ATGGTGGGAATGGGTCAGAAG-3¢...
- 14
- 397
- 0
Từ khóa: apurinic apyrimidinic endonuclease is a novel drug target in cancerspinalin a previously identified nematocyte specific gene is a splice variant derived from a complex genetic locusiguana dzip1 protein is a novel component of the ciliogenic pathway essential for axonemal biogenesis dev dyn 2010 feb 239 2 527 34menispermaceae a novel phytotherapic weapon against allergic diseasesa novel notch effector for maintenance of neural progenitor cells in the neocortexa novel experimental approach to understand viral replication and evolution in vivosa system sys dba admin root and many others the dbo is a user who has implied permissions to perform all activities in the database any object created by any member of the sysadmin fixed server role belongs to dbo automaticallya role in cognitive functions in mice and mena novel strategy for a splice variant selective gene ablation the example of the versican v0 v2 knockoutis ccdc26 a novel cancer associated long chain non coding rnananoparticle a novel lipid based vector for liver gene transfera novel approach towards gene targetingcloning sequencing and expression of a novel goose type lysozyme gene with chitinase ra chic activity from the moderately thermophilic bacterium ralstonia sp a 471aavp a novel hybrid gene delivery systema novel tumor suppressor reic dkk 3 gene identified by our in vitro transformation model of normal human fibroblasts works as a potent therapeutic anti tumor agentBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000BT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam