a novel experimental approach to understand viral replication and evolution in vivo
Báo cáo khoa học: "A Machine Learning Approach to Extract Temporal Information from Texts in Swedish and Generate Animated 3D Scenes" docx
Ngày tải lên :
31/03/2014, 20:20
... Hitzeman et al (1995) proposed a constraintbased approach taking into account tense, aspect, temporal adverbials, and rhetorical structure to analyze a discourse Recently, groups have used machine ... against our Gold Standard As a baseline, we used a simple algorithm that assumes that all events occur in the order they are introduced in the narrative For comparison, we also did an inter-annotator ... Logic Academic Press, New York Andrea Setzer and Robert Gaizauskas 2001 A pilot study on annotating temporal relations in text In ACL 2001, Workshop on Temporal and Spatial Information Processing,...
- 8
- 492
- 0
![interactive storytelling for video games [electronic resource] a player-centered approach to creating memorable characters and stories](https://media.store123doc.com/images/document/14/y/nf/medium_nfv1401472695.jpg)
interactive storytelling for video games [electronic resource] a player-centered approach to creating memorable characters and stories
Ngày tải lên :
31/05/2014, 00:58
... already familiar with are adapted for use in games My Approach to the Job Game stories are drama, and drama is about structure first and foremost and character secondarily What this means is that ... setting and backstory (as in Grand Theft Auto IV and Heavy Rain) and/ or to provide an epilogue to bridge the gap between a game and its sequel (as in Prince of Persia) Perhaps the most important change ... best gameplay and stories the genre has ever seen FINAL FANTASY VI in particular is known for its diverse and interesting cast of characters (including fan favorite villain Kefka) and deep story,...
- 332
- 423
- 0
báo cáo hóa học:" Research Article A General Iterative Approach to Variational Inequality Problems and Optimization Problems Jong Soo Jung" ppt
Ngày tải lên :
21/06/2014, 11:20
... for nonexpansive mappings and monotone mappings,” Journal of Mathematical Analysis and Applications, vol 334, no 2, pp 1450–1461, 2007 H Iiduka, W Takahashi, and M Toyoda, “Approximation of solutions ... Stampacchia, “Variational inequalities,” Communications on Pure and Applied Mathematics, vol 20, pp 493–519, 1967 F Liu and M Z Nashed, “Regularization of nonlinear ill-posed variational inequalities ... Journal of Mathematical Analysis and Applications, vol 20, pp 197–228, 1967 R T Rockafellar, “On the maximality of sums of nonlinear monotone operators,” Transactions of the American Mathematical...
- 20
- 366
- 0
Báo cáo y học: "A targeted lipidomics approach to the study of eicosanoid release in synovial joints" pdf
Ngày tải lên :
12/08/2014, 17:22
... (LXA4); prostaglandin E1 (PGE1), 6-keto prostaglandin F 1a (6-keto PGF 1a) , prostaglandin D2 (PGD2), prostaglandin E (PGE ), prostaglandin F a (PGF a) , 11bprostaglandin F a (11b-PGF a) , prostaglandin ... (16,16dimethyl-PGF 2a) was prepared in ethanol (2 ng/μL) and was added to all composite standards at a final concentration of 100 pg/μL Chromatograms for standards were used to establish characteristic ... anti-inflammatory and proresolving lipid mediators: implications for rheumatic diseases Nat Clin Pract Rheumatol 2007, 3:570-579 Sato T, Konomi K, Fujii R, Aono H, Aratani S, Yagishita N, Araya...
- 12
- 433
- 0
A linear prediction approach to dimensional spectral factorization and spectral estimation
Ngày tải lên :
11/11/2015, 04:35
... causal and causally invertible linear shift-invariant filter that whitens a particular random process The term "linear prediction" is used because if a causal and causally invertible whitening ... The fundamental problem of linear prediction is to determine a causal and causally invertible (minimumphase), linear, shift-invariant whitening filter for a given random process In some cases, ... a stationary signal and noise) to obtain a fast algorithm for solving for the timevarying gain matrix [5] Linear prediction is closely related to the problem of solving the wave-equation in a...
- 185
- 212
- 0
Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt
Ngày tải lên :
13/08/2014, 05:20
... contribution to viral replication and viralinduced immortalization in cell culture as well as viral replication kinetics and persistence in inoculated rabbits Our findings indicate that the loss of p28 and ... to quantitate HTLV-2 serum antibody using plasma diluted 1:100 to obtain values within the linear range of the assay Data is shown as absorbance values DNA was isolated from rabbit PBMCs using ... coordination, helped in drafting and finalizing the manuscript All authors read and approved the final manuscript Acknowledgements We thank Kate Hayes for editorial comments on the manuscript and Tim Vojt...
- 11
- 277
- 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
Ngày tải lên :
25/10/2012, 10:45
... Acta Veterinaria Scandinavica 2009, 51:36 Background Files with information on animal disease have a variety of applications at both the herd and national level, including monitoring the incidence ... Variation and bias in data based on clinical examinations can be linked to veterinarians' individual perception of the purpose of, and their motivations for, data collection Some veterinarians ... context That is, treatment data as an indicator of a certain disease manifestation may only be valid within the herd When veterinarians used standard treatment decisions and included population level...
- 10
- 587
- 0
Báo cáo khoa học: A novel mass spectrometric approach to the analysis of hormonal peptides in extracts of mouse pancreatic islets ppt
Ngày tải lên :
17/03/2014, 10:20
... bacterial and mammalian proteomes using a combination of cysteine a nity tags and 15N-metabolic labeling Anal Chem 73, 2132–2139 Shen, Y., Zhao, R., Belov, M.E., Conrads, T.P., Anderson, G .A. , ... radioimmunoassay of insulin and glucagon [24–26] The supernatant contained approximately 25 lg insulin and lg glucagon, which corresponded to 13.2 ng insulin and 2.3 ng glucagon per islet A volume ... end-plate potentials of the ion trap were set at 1.5 V and the duration of the electron pulse was 100 ms Data acquisition and handling Primary data analysis was performed on a workstation running...
- 7
- 491
- 0
Báo cáo y học: " Variability in a dominant block to SIV early reverse transcription in rhesus monkey cells predicts in vivo viral replication and time to death" pot
Ngày tải lên :
12/08/2014, 04:20
... participated in all assays SL participated in B-LCL phenotyping and staging assay TS participated in B-LCL phenotyping, staging, and fusion assay TC participated in staging and fusion assay AH participated ... findings underscore that an innate antiviral response, which is capable of inhibiting early RT, can impact the in vivo clinical outcome of the animals infected with SIV A complete understanding ... forward, 5'-AAGCAAGTGTGTGTTCCCATCT-3'; late RT reverse, 5'-CACTTACCTGCAACCGGAGG-3'; integrated forward, 5'-GCTGCCGATTGGGATTTACAAC3'; integrated reverse, 5'-AATGTCTGATCCTCTTGGCTCTC-3' Quantification...
- 11
- 340
- 0
Báo cáo y học: "APOBEC3G induces a hypermutation gradient: purifying selection at multiple steps during HIV-1 replication results in levels of G-to-A mutations that are high in DNA, intermediate in cellular viral RNA, and low in virion RNA" pps
Ngày tải lên :
13/08/2014, 05:21
... Vif was amplified using the forward primer YRHHYmutF, 5'GGAAAGCTAAGGACTGGT TTGCTGCAGCTGCCGCTGAAAGTACTAATCCAAAAATA AG3', and the reverse primer VifR, 5'GGATAAACAGCAGT TGTTGC3' The resulting amplicons ... the proviral DNA, cRNA, and vRNA across each individual infection (YA, YB and YC) for Rounds and was determined Statistical significance was calculated using the t-test assuming equal variance ... DNA and RNA extraction A ml aliquot of fresh CEM-CM was then added to the remaining ml cell and virus suspension and the sample incubated for another days DNA extraction and PCR DNA was extracted...
- 15
- 320
- 0
Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf
Ngày tải lên :
13/08/2014, 16:20
... most of the skin resistance to chemical and physical attacks, and in their normally dehydrated state also provide obstacles against water loss through the skin A diffusing molecule has to cross multiple ... media”, which means that the pores (voids) and grains comprising the matrix are treated as a continuum, and equivalent macroscopic hydraulic properties are assigned to it Mass transport in water ... observation point is near the top and within a corneocyte; observation points 4, and are within an intercellular channel; and observation point is within a lower corneocyte Concentrations are observed...
- 25
- 373
- 0
Báo cáo y học: " A new computational approach to analyze human protein complexes and predict novel protein interactions" pdf
Ngày tải lên :
14/08/2014, 08:20
... coordination of the biological part and helped to draft the manuscript All authors read and approved the final manuscript Additional data files The following additional data are available with ... with rabbit anti-goat Alexa 555 (Invitrogen Molecular Probes, Carlsbad, CA, USA) F-actin was stained by phalloidin Alexa 633 (Invitrogen, Carlsbad, CA, USA) Images were acquired with a Leica DMIRE2 ... Additional data file 9) It is known that both PAK1 and EEA1 are involved in growth factor stimulated [36,37] macropinocytosis [38] and that PAK1 localizes to ruffling F-actin areas where macropinosomes...
- 15
- 286
- 0
A metabolomics approach to understand mechanism of heat stress response in rat
Ngày tải lên :
11/09/2015, 21:52
... potassium, calcium, inorganic phosphorus, triiodothyronine (T3) and thyroxine (T4) and the activities of aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), ... holistic nature, FT-IR spectroscopy is a valuable metabolic fingerprinting/ footprinting tool owing to its ability to analyse carbohydrates, amino acids, lipids and fatty acids as well as proteins and ... applications and metabolomic data handling and knowledge extraction In the third part, metabolic pathways and networks and the applications of pathway analysis have been highlighted 2.1 Heat Stress Metabolism...
- 120
- 468
- 0
A real time approach to process control 2ed
Ngày tải lên :
01/01/2014, 17:44
... engineering For undergraduate programs looking to transition away from the traditional mathematical-based approach to a more applied, hands-on approach, this text will be an invaluable aid.’ Charles ... right angles to the main sail of a windmill, thus always keeping the main windmill drive facing into the wind It was not until the Industrial Revolution, particularly in England, that feedback ... batch-type simulation sessions It is imperative that a dynamic simulation is ‘packaged’ in a way that makes it easy to use and learn, yet still be applicable to a broad range of applications and...
- 327
- 548
- 0
Tài liệu A Public Health Approach to Children’s Mental Health - A Conceptual Framework pdf
Ngày tải lên :
12/02/2014, 12:20
... children’s mental health care system, and partner systems and organizations to work together in a coordinated and comprehensive approach will take time and perseverance One thing that can sustain the ... Identifying what to measure and what to with the data is vital because this information offers a key starting point for leaders and coalitions that are interested in moving communities forward in adopting ... health and in the practice of health care Health care practitioners collect data on an individual patient by taking a medical history and conducting a physical exam, whereas public health practitioners...
- 141
- 470
- 0
Tài liệu A Client-Centered Approach to Reproductive Health: A Trainer’s Manual docx
Ngày tải lên :
13/02/2014, 10:20
... as training tools and as useful tools to energize and relax participants They are explained within the module when they are to be used TRAINING MATERIALS AND TOOLS Training materials are a resource ... involve the trainer defining concepts and giving basic information to the participants Both brainstorming and group discussions involve participants actively in defining concepts and generating ... undergone basic training in the clientcentered approach The trainers should be experienced in encouraging and motivating trainees to participate fully in the training in order to take away the most...
- 287
- 500
- 0
Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc
Ngày tải lên :
19/02/2014, 19:20
... pre-reordering based SMT system, but also be integrated into a phrasebased decoder serving as additional distortion features We evaluated our approach on large-scale Japanese-English and English-Japanese ... Graepel, and Klaus Obermayer 2000 Large Margin Rank Boundaries for Ordinal Regression In Advances in Large Margin Classifiers, pages 115-132 Philipp Koehn, Amittai Axelrod, Alexandra Birch Mayne, ... Zhang, Mu Li and Ming Zhou and Yi Guan 2007 A Probabilistic Approach to Syntax-based Reordering for Statistical Machine Translation In Proc ACL, pages 720-727 Yang Liu, Qun Liu, and Shouxun Lin...
- 9
- 615
- 0
Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx
Ngày tải lên :
20/02/2014, 12:20
... Conclusion In this paper, we have demonstrated that, for a standard trigram HMM, taking a Bayesian approach to POS tagging dramatically improves performance over maximum-likelihood estimation Integrating ... no gold standard available Luckily, the Bayesian approach allows us to automatically select values for the hyperparameters by treating them as additional variables in the model We augment the ... heads, and assigns equal probability to t = and t = for any sequence that does contain exactly five heads — a counterintuitive result In contrast, using some standard results in Bayesian analysis...
- 8
- 523
- 0
Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx
Ngày tải lên :
20/02/2014, 12:20
... feature, which indicates the state of a simple finite-state automaton that only has two states The automaton is set to initial state (q0) at the top of a message It makes a transition to state ... Perceptron Learner, in all cases we evaluate combinations of alternative history sizes (0 and 1) and alternative feature sets (base and base+AllContext) In our experimentation we have evaluated larger ... scheme that novel thread based features have a greater and more consistent impact on classification performance Data and Coding We make use of an available annotated corpus of discussion data where...
- 4
- 518
- 0