spinalin a previously identified nematocyte specific gene is a splice variant derived from a complex genetic locus
Báo cáo y học: " Profiling RE1/REST-mediated histone modifications in the human genome" pps
Ngày tải lên :
14/08/2014, 21:20
... Guardavaccaro D, Frescas D, Dorrello NV, Peschiaroli A, Multani AS, Cardozo T, Lasorella A, Iavarone A, Chang S, Hernando E, Pagano M: Control of chromosome stability by the beta-TrCP-RESTMad2 ... understanding of the intricate and nuanced roles of REST in neural development, organogenesis, human disease states and as potential disease biomarkers and novel therapeutic targets Volume 10, Issue ... context -specific and nuanced manner, and thus create an elaborate platform for histone code readers [42] As a result, the interaction of histone methylases and methyltransferases has the potential...
- 20
- 181
- 0
Báo cáo y học: " Asymmetric histone modifications between the original and derived loci of human segmental duplications" pptx
Ngày tải lên :
14/08/2014, 20:22
... modification A similar approach was applied to map genes or pseudogenes into SDs, but a gene or pseudogene was assigned to an SD if it overlaps this SD by at least bp Figure illustrates the approach ... in gene activation while H3K27 methylation and H3K9 methylation are associated with gene repression As histone modifications can be viewed, to a great extent, as a characteristic of functional ... of gene regulation, which in turn can facilitate an organism's adaptation to environmental change [6-9] For example, the expression of yeast duplicated genes appears to have evolved asymmetrically,...
- 13
- 615
- 0
Data Binding and Silverlight List Controls
Ngày tải lên :
05/10/2013, 03:20
... columns in the DataGrid To this, add the DataGrid.Columns collection, as follows: ... from the data source Enter the following code: ... Headers of the columns to Nickname and Notes accordingly ...
- 32
- 347
- 1
Tài liệu Báo cáo khoa học: Effect of siRNA terminal mismatches on TRBP and Dicer binding and silencing efficacy pdf
Ngày tải lên :
18/02/2014, 06:20
... Zerivitz K & Akusjarvi G (1995) Small-Scale Preparation of Nuclear Extracts from Mammalian Cells Academic Press, London Supporting information The following supplementary material is available: Fig ... Kini and S P Walton A Mismatches affect TRBP and Dicer binding A B B Fig Effect of terminal mismatch at the guide strand 5¢ end on siRNA–TRBP and siRNA–Dicer complex formation (A) EMSA of siRNA–TRBP ... internal stability may result from an as yet uncharacterized function of TRBP in RNAi Here, we have characterized the interactions of siRNAs that contain terminal mismatches with TRBP and Dicer, and...
- 10
- 700
- 0
Tài liệu Báo cáo khoa học: Tet repressor mutants with altered effector binding and allostery docx
Ngày tải lên :
20/02/2014, 01:20
... as a negative control (5¢-ctaataaaattaatcatttatggcataggcaacaag-3¢) All samples were incubated in complex buffer containing 0.02 m Tris ⁄ HCl (pH 8.0) and mm MgCl2 Atc and 4-ddma-atc were added ... to TetR allostery Experimental procedures Materials and general methods Atc was from Acros (Geel, Belgium) and 4-ddma-atc was synthesized by Susanne Lochner and Peter Gmeiner (Pharmazeutische Chemie, ... helix a4 was performed by PCR mutagenesis with the primers a4 deg_H64K (5¢-aataagcgggccctactggatgcgctggcggt ggagatcttggcgcgtcataaggattat-3¢; the underlined positions contain 89% wild-type and 11%...
- 10
- 527
- 0
Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot
Ngày tải lên :
06/03/2014, 22:21
... DNA13-RNA4(5¢-AATAGAGAAAAAGaaaaAAGATGGCAA DNA12 AG-3¢), 29 base DNA15-RNA1-DNA13 (5¢-AATAGAGAA AAAGAAaAAAGATGGCAAAG-3¢) and 3¢-FAM-labeled 18 base RNA9-DNA9 (5¢-uugcaugccTGCAGGTCG-3¢) with a ... maritima MSB8, which was obtained from the American Type Culture Collection (Manassa, VA, USA), was used as a template The sequences of the PCR primers are 5¢- TGGGTTTGAGAGCATATGAAGTTGG CAAAAAAATACTAC-3¢ ... 45 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M (1991) Stabilization of Escherichia coli ribonuclease Role of HBD from T maritima RNase...
- 16
- 459
- 0
Báo cáo khoa học: Inhibition of an iron-responsive element/iron regulatory protein-1 complex by ATP binding and hydrolysis docx
Ngày tải lên :
07/03/2014, 09:20
... lm (Fig 7D) 3112 ATPase activity is enhanced in the presence of IRE Binding to RNA and ATPase activity are characteristics of RNA helicases, and RNA binding increases the ATPase activity of these ... bound to RNA at lower ATP concentrations, but at higher concentrations it hydrolyzes ATP and dissociates from RNA This means that a low local ATP level maintains the IRP-1–IRE complex at high iron ... recombinant IRP-1 and the indicated amount of IRE RNA Values are means ± SD from three separate experiments *Significantly greater than IRP-1 alone (P < 0.05) (B) Autoradiogram of a thin layer chromatogram...
- 12
- 448
- 0
Báo cáo khoa học: GTP binding and hydrolysis kinetics of human septin 2 pot
Ngày tải lên :
07/03/2014, 12:20
... NaCl was added Protein concentration was determined using the Bradford reagent (Bio-Rad, Mississauga, ON, Canada) The dialyzed proteins were stored at a concentration of 1 mgÆmL)1 at )80 °C and ... Canada) for TLC, separated by 0.75 m KH2PO4, pH 3.65 and quantified on a Storm 860 Laser Scanner (Molecular Dynamic Co., Sunnyvale, CA, USA) using ImageQuant software (ImageQuant, GE Healthcare) ... not appear to have self-stimulatory GAP activity when incubated at increasing concentrations (data not shown) This is in contrast to several other Rho family members such as RhoC, human Cdc42 and...
- 13
- 469
- 0
Pleasure and Its Modifications: Witasek, Meinong and the Aesthetics of the Grazer Schule potx
Ngày tải lên :
07/03/2014, 12:20
... consciousness oscillates are actual judgments: the first asserts that what is seen is a real object (a ball) existing in nature; the second that what is seen is a mere imitation (a drawing of a ball) Now ... complex state of affairs to which all the individual constituents make their separate contribution, the state of affairs that what is seen appears as a ball, but is only a piece of paper treated ... thank also Reinhard Fabian and Kevin Mulligan for valuable bibliographical assistance and helpful comments The thesis that all acts have objects is of course nothing other than Brentano's thesis...
- 31
- 504
- 0
Báo cáo khóa học: Surface nucleolin participates in both the binding and endocytosis of lactoferrin in target cells potx
Ngày tải lên :
07/03/2014, 15:20
... Biotechnology (Santa Cruz, CA, USA) Goat FITC- or tetrarhodamine isothiocyanate (TRITC)-conjugated antirabbit IgG were obtained from Sigma Rabbit Alexa Fluor 546-labeled anti-mouse IgG was from Molecular ... template and the following oligonucleotides: 5¢-TGGTATGACTAGGAAATTTGGT TATGTG-3¢ and 5¢-GACAGAAGCTATTCAAACTTC GTCTTC-3¢ The PCR product was subcloned in plasmid pGEX-4T-2 (Amersham Pharmacia Biotech), ... b-galactosidase activity was measured at 48 h postinfection (at an absorbance of 570 nm) The mean ± SD of triplicate assays of a representative experiment is shown (B) Assay of HIV-1 LAI attachment...
- 15
- 509
- 0
Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot
Ngày tải lên :
08/03/2014, 23:20
... purchased from Molecular Probes All other reagents were of analytical grade Membrane and protein preparation Sarcoplasmic reticulum (SR) and the purified Ca2þ ATPase were prepared from rabbit ... fluorescence ATP binding to Ca21-ATPase ATP binding to purified Ca2þ ATPase was also measured using radiolabelled ATP as described by Champeil et al [26] Briefly, 0.3 mg·mL21 of purified ATPase was added ... similar to thapsigargin and elevates [Ca2þ]cyt (i.e inhibit Ca2þ uptake), this would be the most obvious mode of action Platelet aggregation, inflammation, and arachadonic acid production are all processes...
- 10
- 594
- 0
Báo cáo khoa học: Ligand binding and antigenic properties of a human neonatal Fc receptor with mutation of two unpaired cysteine residues docx
Ngày tải lên :
16/03/2014, 06:20
... I-related receptor consisting of a heavy chain (HC) with three ectodomains (a1 , a2 and a3 ), a transmembrane part and a short intracellular signaling tail Like MHC class I HC, the FcRn counterpart ... Sundaresan G, Subbarayan M, Carter NH, Ikle DN, Yazaki PJ, Chatziioannou AF, Gambhir SS et al (2005) Tailoring the pharmacokinetics and positron emission tomography imaging properties of anti-carcinoembryonic ... human HC variants Table S3 Numbers of cysteine residues of FcRn HCs across speciesa Table S4 Numbers of cysteine residues of nonclassical MHC class I HCa This material is available as part of the...
- 14
- 533
- 0
Báo cáo khoa học: Importance of tyrosine residues of Bacillus stearothermophilus serine hydroxymethyltransferase in cofactor binding and L-allo-Thr cleavage Crystal structure and biochemical studies pot
Ngày tải lên :
16/03/2014, 06:20
... for a two-base mechanism involving tyrosine-265 from arginine-219 mutants of alanine racemase Biochemistry 38, 4058– 4065 Bhavani S, Trivedi V, Jala VR, Subramanya HS, Kaul P, Prakash V, Appaji ... candidate for proton abstraction from Ca of Gly and 3-hydroxy amino acids, and that Y51 is involved in PLP binding An alternative mechanism, for the cleavage of 3-hydroxy amino acids via the abstraction ... (5¢-GACGAACAAATTCGCGGAAGG-3¢) and anti-sense (5¢-CCTTCCGCGAATTTGTTCGTC-3¢) primers and Deep Vent Polymerase (New England Biolabs, Beverly, MA, USA) The Y61F bsSHMT and Y6 1A bsSHMT mutants were also...
- 14
- 364
- 0
Báo cáo khoa học: Functional analysis of cell-free-produced human endothelin B receptor reveals transmembrane segment 1 as an essential area for ET-1 binding and homodimer formation pptx
Ngày tải lên :
16/03/2014, 10:20
... and binding kinetics were evaluated using biaevaluation 3.1 software In general, signals obtained from the Biacore assay were lower than expected for loading of ETBcHx as a relatively large analyte, ... Lombardi A, Pietraforte I, Novelli F, Donato MD, Sperandei M, Tornambe A, Fraioli R, Martayan A, Natali PG et al (2006) Functional expression of a single-chain antibody to ErbB-2 in plants and ... cET-1 ligand was detected by specific absorption at 550 nm Peak area values were calculated by smart manager software and plotted with kaleidagraph 3.52 software Nonspecific binding of cET-1 was monitored...
- 13
- 433
- 0
Báo cáo khoa học: Identification and characterization of oxidized human serum albumin A slight structural change impairs its ligand-binding and antioxidant functions pptx
Ngày tải lên :
16/03/2014, 13:20
... 153–158 Soejima A, Matsuzawa N, Hayashi T, Kimura R, Ootsuka T, Fukuoka K, Yamada A, Nagasawa T & Era S (2004) Alteration of redox state of human serum albumin before and after hemodialysis Blood ... We are grateful to Dr Masaichi-Chang-il Lee, Clinical Care Medicine Division of Pharmacology, Kanagawa Dental College, for valuable advice on ESR analysis We also thank Dr Itsuya Tanabe and other ... Era S, Kuwata K, Imai H, Nakamura K, Hayashi T & Sogami M (1995) Age-related change in redox state of human serum albumin Biochim Biophys Acta 1247, 12–16 12 Imai H, Hayashi T, Negawa T, Nakamura...
- 12
- 479
- 0
Báo cáo khoa học: Coiled–coil interactions modulate multimerization, mitochondrial binding and kinase activity of myotonic dystrophy protein kinase splice isoforms pptx
Ngày tải lên :
16/03/2014, 13:20
... 5¢-ATAGAATTCATGTCAGCCGAAGTGCG3¢ and 5¢-ATTCTCGAGTCAAGTGAGCCGGTCCTCCA3¢; pSGVSVDMPK E(1–400): 5¢-ATAGAATTCATGTCA GCCGAAGTGCG-3¢ and 5¢-AATCTCGAGTCAGAAGG GCAGGCGCAC-3¢; pSGVSVDMPK E(60–375): 5¢-ATA ... pSGVSVDMPK E(60–375): 5¢-ATA GAATTCAGGCTTAAGGAGGTCCGA-3¢ and 5¢-ATT CTCGAGTCAAGTGAGCCGGTCCTCCA-3¢; pSGVSVD MPK E(340–537): 5¢-ATTGAATTCTTTGGCCTTGATTG GGA-3¢ and 5¢-ATACTCGAGCTAGGGATCTGCGGCT3¢; pSGVSVDMPK ... Mountain View, CA, USA) MYPT2 was cloned by RT-PCR using mouse skeletal muscle RNA and primers 5¢-ATAGAATTCATGGCGGA GCTGGAGCA-3¢ and 5¢-ATACTCGAGCTACTTGGAC AGTTTGCTGATGACT-3¢ (start and stop codons...
- 13
- 392
- 0
Báo cáo khoa học: Binding and activation of nitric oxide synthase isozymes by calmodulin EF hand pairs potx
Ngày tải lên :
16/03/2014, 13:20
... (%) NADPH oxidation (%) Cyt c reduction (%) • CaM protein NADPH oxidation (%) • CaM nCaM cCaM CaMNN CaMCC CaM (EDTA) 100 93 100 ± 37 ± NAA 90 ± NAA NAA 100 ± NAA NAA 81 ± NAA NAA 100 ± 5± NAA 115 ... CaM protein was loaded in a standard SDS ⁄ PAGE buffer containing mM EDTA Lane 1, low molecular mass protein standard (Bio-Rad); lane 2, wild-type CaM; lane 3, nCaM; lane 4, cCaM; lane 5, CaMNN; ... Calmodulin domain activation of NOS D E Spratt et al Each domain of CaM contains an EF hand pair The C-terminal EF hand pair has an affinity for Ca2+ (Kd ¼ 10)6 m) 10-fold greater than the...
- 13
- 336
- 0
Báo cáo khoa học: Characterization of the Drosophila Methoprene -tolerant gene product Juvenile hormone binding and ligand-dependent gene regulation potx
Ngày tải lên :
16/03/2014, 18:20
... (long and accurate Taq polymerase, Takara) with the primer pair based on the published sequence [19]: 5¢-GCCGAATTCCAACATGGC AGCACCAGAGACGGG-3¢; 5¢-GCCTCTAGATCATCG CAGCGTGCTGGTCAG-3¢ The amplified ... proteins that are key players in a wide array of developmental and physiological pathways such as neurogenesis, circadian rhythms, hypoxia response, and toxin metabolism [20,21] PAS is an acronym from ... Squalene, farnesol and geraniol were from Sigma Farnesyl acetate was from Aldrich cDNA cloning of Met Total RNA was isolated from S2 cells as described previously [50] First-strand cDNA was synthesized...
- 10
- 421
- 0
Báo cáo khoa học: Novel ATP-binding and autophosphorylation activity associated withArabidopsisand human cryptochrome-1 pptx
Ngày tải lên :
17/03/2014, 10:20
... progress Acknowledgements We are indebted to Dr Paul Galland for valuable advice, Nabil Lounis for help with phosphorylation studies, Alain Picaud for the phospho´ amino acid analysis, Andre Klarsfeld ... Sancar, A (1995) Putative blue-light photoreceptors from Arabidopsis thaliana and Sinapis alba with a high degree of sequence homology to DNA photolyase contain the two photolyase cofactors but lack ... cryptochromes (A) ATP agarose a nity purification of Arabidopsis cryptochrome visualized on Coomassiestained gels Lane 1, purified protein before binding reaction; lane 2, supernatant after incubation with...
- 8
- 242
- 0