a novel approach towards gene targeting
One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires
... L9 [2] H Sahaf, L Masson, C Leandri, B Auffray, G Le Lay, F Ronci, Appl Phys Lett 90 (2007) 263110 [3] M .A Valbuena, J Avila, M.E Davila, C Leandri, B Aufray, G Le Lay, M.C Asensio, Appl Surf ... filled states STM images of the surface following the evaporation of Å of THAP are displayed in Fig 3a and b Each molecule appears as a six-pronged shape with six bright lobes and a dark center The ... nice, clean and well characterized THAP monolayers [10,11] The PQ molecules, purchased from Sigma–Aldrich, were loaded under nitrogen atmosphere in a glass ampoule connected to a UHV leak valve This...
- 5
- 465
- 0
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx
... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A2 (Q42578) and HRP-C (AAA33377) Residue numbers start at the putative mature proteins by analogy with HRP-C Preprotein ... Analysis and expression of the class III peroxidase large gene family in Arabidopsis thaliana Gene 288, 129–138 Tanaka S, Ikeda K, Ono M & Miyasaka H (2002) Isolation of several anti-stress genes...
- 14
- 347
- 0
Báo cáo khoa học: "A Novel Approach to Semantic Indexing Based on Concept" ppt
... information retrieval are based on the statistic method We propose an approach that changes the basic index term weighting method by considering semantics and concepts of a document In this approach, ... information ratio rather than information quantity as the semantic weight of indexes This approach has an advantage in that we need not consider document length when indexing because the overall text ... normalized as an average The results of manually extracted index terms and their weights are given in Table The index term weight and the relevance score are obtained by averaging the individual...
- 6
- 348
- 0
Báo cáo hóa học: " Research Article A Novel Approach to Detect Network Attacks Using G-HMM-Based Temporal Relations between Internet Protocol Packets" pot
... anomaly modeling, we generated a variety of anomaly attack data such as covert channels, malformed packets, and some DoS attacks The simulated attacks were included in one of following five categories, ... training dataset had only normal traffic because they had unlabeled learning ability In case of G-HMM, G-HMM made a normal behavior model using normal data, and then G-HMM calculated the ML values ... the total number of normal data The false negative rate is defined as the total number of attack data that were incorrectly classified as normal traffic divided by the total number of attack data 7.1...
- 14
- 499
- 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc
... EURASIP Journal on Advances in Signal Processing delay can always be obtained that ranges below the group delay of a corresponding LP FIR filter However, the absolute minimum value of the passband ... minimizes aliasing and imaging The demand for low group delay particularly of the AFB prototype filters has not been asked for explicitly Based on the algorithm [15] the approach [16] introduces additional ... overall single-input single-output (SISO) transfer function of the filter bank pair that ideally approximates a linear-phase allpass function We show that both the magnitude and the group delay...
- 13
- 623
- 0
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx
... directed acyclic graph (DAG) The objective function incorporates several constraints on the available silicon area (hardware capacity), B Knerr et al memory (software capacity), and latency as a timing ... control-oriented functionality (an ARM for the signalling part and a StarCore for the multimedia part) It features several hardware accelerating units (ASICs), for the more data-oriented and computation intensive ... vertex; a more elaborate approach is the generation of two schedules, as soon as possible and as late as possible as in Figure For some vertices, we obtain the very same start times st(v) = stasap...
- 13
- 310
- 0
Báo cáo hóa học: " Ultra violet sensors based on nanostructured ZnO spheres in network of nanowires: a novel approach" pdf
... http://gtresearchnews.gatech.edu/newsrelease/nanohelices htm T Makino, Y Segawa, M Kawasaki, A Ohtomo, R Shiroki, K Tamura, T Yasuda, H Koinuma, Appl Phys Lett 78, 1237 (2001) S.S Hullavarad, S Dhar, B Varughese, I Takeuchi, T Venkatesan, ... furnace was flushed by Ar gas and was latter stabilized with a flow rate of 40– 50 sccm When the furnace reaches 420 °C, the Zn metal evaporates and O2 gas was introduced with the combined gas mixture ... material Our experiments to understand the effect of gas kinetics in controlling the shapes are underway and can be found elsewhere (S S Hullavarad and P.C Karulkar, under preparation) Mo et al...
- 7
- 403
- 0
Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx
... M, Miyagawa S, Kakazu T: Radical operation after portal embolization for tumor of hilar bile duct J Am Coll Surg 1994, 178:480-486 Kawasaki S, Makuuchi M, Kakazu T, Miyagawa S, Takayama T, Kosuge ... liver parenchyma Br J Surg 1999, 86:784-788 Kokudo N, Tada K, Seki M, Ohta H, Azekura K, Ueno M, Ohta K, Yamaguchi T, Matsubara T, Takahashi T, Nakajima T, Muto T, Ikari T, Yanagisawa A, Kato Y: ... Preoperative portal vein embolization for extension of hepatectomy indications Hepatology 1996, 24:1386-1391 Imamura H, Shimada R, Kubota M, Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S:...
- 7
- 384
- 0
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx
... MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and OA [2-4] ... Stein-Picarella M, Niedbala MJ: Expression of matrix metalloproteinase (96-kd gelatinase B) in human rheumatoid arthritis Arthritis Rheum 1996, 39:1576-1587 Yoshihara Y, Nakamura H, Obata K, Yamada ... final manuscript 14 15 Acknowledgements The authors thank Ms Marie Désy for statistical analysis The work was supported by a grant from the Canadian Arthritis Network YS-P and AJdBF are scholars...
- 10
- 494
- 0
Báo cáo y học: "Rationale, design and methodology for Intraventricular Pressure Gradients Study: a novel approach f" doc
... outflow-tract pressure gradient and apical and basal myocardial segments lengthening changes at basal, afterloaded and ischemic conditions Afterload manipulation Sudden afterload elevations are performed ... conventional fashion Echocardiography All patients will have standard two-dimensional echocardiographic examinations before and after AVR LV ejection fraction is assessed visually by a trained echocardiographer ... disease that are worse than mild as assessed clinically and/ or confirmed by pulmonary function testing (Table 1) The baseline and follow-up clinical variables and pharmacological data are obtained...
- 6
- 377
- 0
báo cáo khoa học: "Canine parvovirus-like particles, a novel nanomaterial for tumor targeting" pptx
... Yamauchi N, Takahashi M, Sasaki K, Fukaura J, Neda H, Fujii S, Hirayama M, Itoh Y, Koshita Y, Kogawa K, Kato J, Sakamaki S, Niitsu Y: In vivo gene delivery to tumor cells by transferrinstreptavidin-DNA ... indicative of particle size, intactness and packaged nucleic acid material SEC of a freshly purified VLP preparation revealed that the absorbance at 260 nm was high compared to absorbance at 280 nm ... human cancer Neoplasia 2003, 5:495-506 Maranga L, Rueda P, Antonis AF, Vela C, Langeveld, J.P., Casal JI, Carrondo MJ: Large scale production and downstream processing of a recombinant porcine parvovirus...
- 11
- 414
- 0
Báo cáo y học: "A novel approach to sonographic examination in a patient with a calf muscle tear: a case report" docx
... serosanguinous fluid was aspirated (Figure 3) Dramatic pain relief was noted after aspiration An elastic stocking was applied to his left calf area after aspiration and follow-up two weeks later ... muscle Am J Sports Med 1977, 5:191-193 Takebayashi S, Takasawa H, Banzai Y, Miki H, Sasaki R, Itoh Y, Matsubara S: Sonographic findings in muscle strain injury: clinical and MR imaging correlation ... machine and S12 5–12 MHz real-time linear–array transducer (Philips Medical Systems) were used to examine the patient After careful examination, bilateral symmetrical sonographic findings of the calf...
- 4
- 316
- 0
Báo cáo khoa học: "A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" docx
... protection against invading pathogens but also interacts with the adaptive immune system to optimize the pathogen-specific humoral and cellular defense cascade in the body, especially for viral pathogens ... prepared the paper CRW, HHL, YW, YSS, LYH and YSZ participated in developing the hypothesis and collaborated in writing and reviewing of the article All authors read and approved the final manuscript ... References McCarthy M: AIDS vaccine fails in Thai trial Lancet 2003, 362:1728 McCarthy M: HIV vaccine fails in phase trial Lancet 2003, 361:755-756 Cohen J: Promising AIDS vaccine's failure leaves field...
- 4
- 287
- 0
Báo cáo khoa học: " A novel approach to inhibit HIV-1 infection and enhance lysis of HIV by a targeted activator of complement" doc
... protection against invading pathogens but also interacts with the adaptive immune system to optimize the pathogen-specific humoral and cellular defense cascade in the body, especially for viral pathogens ... prepared the paper CRW, HHL, YW, YSS, LYH and YSZ participated in developing the hypothesis and collaborated in writing and reviewing of the article All authors read and approved the final manuscript ... References McCarthy M: AIDS vaccine fails in Thai trial Lancet 2003, 362:1728 McCarthy M: HIV vaccine fails in phase trial Lancet 2003, 361:755-756 Cohen J: Promising AIDS vaccine's failure leaves field...
- 4
- 271
- 0
Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx
... vision, as others have also adopted this strategy as a way forward in molecular analysis Alagaratnam et al are utilising Bayesian approaches to pursue muscular dystrophy diagnosis [223] Similarly, ... 17(5):323-329 Ito M, Nakamura F, Baba A, Tamada K, Ushijima H, Lau KHA, Manna A, Knoll W: Enhancement of surface plasmon resonance signals by gold nanoparticles on high-density DNA microarrays J Phys Chem ... 51(12):2333-2340 Okamoto M, Kawabe T, Iwasaki Y, Hara T, Hashimoto N, Imaizumi K, Hasegawa Y, Shimokata K: Evaluation of interferon-gamma, interferon-gamma-inducing cytokines, and interferongamma-inducible...
- 17
- 377
- 0
Báo cáo y học: " A novel approach for prediction of tacrolimus blood concentration in liver transplantation patients in the intensive care unit through support vector regression" doc
... creatinine [CR] and urea [UR]) or liver dysfunction (alanine aminotransferase [ALT], aspartate aminotransferase [AST], gamma-glutamyl transpeptidase [GGT], total and conjugated bilirubin, alkaline ... input variables Background Hospital information systems in intensive care medicine generate large datasets on a daily basis These rapidly increasing amounts of data make the task of extracting ... study by Willis and colleagues [42], using a population pharmacokinetic model based on Bayesian forecasting and adapted for individual pharmacokinetic, demographic, and covariate data, resulted in...
- 7
- 318
- 0
Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf
... through appendages such as hair follicles and sweat glands Although the relative importance of each is still not clear, there is a general consensus that the intercellular pathway plays a major ... media as applied to groundwater flow modelling [15,16] Following such an approach, geologic materials -and in our case the SC- may Page of 25 Marquez-Lago et al Theoretical Biology and Medical ... numerical approach was A Keratinocytes Intercellular channels B Figure Brick and mortar structure of corenocytes (a) View from above and (b) three-dimensional lateral view Marquez-Lago et al Theoretical...
- 25
- 373
- 0
Báo cáo y học: "A novel approach to identifying regulatory motifs in distantly related genomes" pps
... TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGCGGA TCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG ... GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCTGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCACTCCCTCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG ... TCCGGTGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCGGGGG TAGCCCACGACAGCCAAATAATAATGAATCATTTCATAAATAATGGGTTTAGGGGCTTATCGGGA Rn Mm Pt Hs Fr GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG GTCCCCGCTCCCTCCGGAGAAATTGCCAAATTAAAATGAATCATTTGGCCCATAATGGCCGAGGCGCTTATCG...
- 18
- 389
- 0
Báo cáo sinh học: " A trial of somatic gene targeting in vivo with an adenovirus vector" pdf
... pair LZT-U (5'-CGAAGAGGCCCGCAC-3') and LZT-MA (5'-TAATGGGCTAGGTTACGTTGGTGTAG-3'), and the primer pair LZT-MS (5'-TAACCTAGCCCATTACGGTCAATCC-3') and LZT-D (5'-GGCAACATGGAAATCGC-3') were mixed and ... recombination Lambda transgene (λgt10 lacZ ) in mouse genome lacZ 8.1 kb B Wild type AdNY57 Wild type AdNY58 Glu461 AAT GAA TCA TTA CTT AGT Glu461Gly AAT GGA TCA TTA CCT AGT Tyr105 ACC TAT CCC TGG ATA GGG ... PCR products generated with the primer pair LZG-U (5'-ACCGGCGATGAGCGAA-3') and LZG-MA (5'-GCCTGATCCATTCCCCAGCGACCA-3'), and the primer pair LZG-MS (5'-GGGAATGGATCAGGCCACGGCCGC-3') and LZG-D (5'-GGGCTGGTCTTCATCC-3'),...
- 11
- 323
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25