The small GTPASE ARF like protein 1 (ARL1) is a new regulator of golgi structure and function

... ClassII: ARF4 , ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ARF6 Fig Classification of mammalian ARF famlily small GTPases Ran Sar Sar 1a, Sar1b Fig A schematic ... human ARF3 human ARF3 human ARF4 human ARF4 human ARF5 human ARF5 human ARF6 human ARF6 rat Arl1 rat Arl1 human Arl5 human Arl5 human Arl8 human Arl8 human Arl4 human Arl4 human Arl7 human Arl7 ... 1. 3 .1 ARF1 1. 3.2 Arl1 1. 3.3 Arl2 1. 3.4 Arl3 1. 3.5 Arl4 1. 3.6 Arl4L 1. 3.7 Arl5 1. 3.8 Arl6 1. 3.9 Arl7 1. 3 .10 Arl8 1. 3 .11 ARFRP1 1. 3 .12 ARD1 1. 4 Rationale of this Study iv Chapter 2 .1 Materials and...

Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx

... GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 ... Journal 278 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 11 31 PTI1-4, a common target of OXI1 and MAPKs C Forzani et al AGC2-3) were also identiﬁed as PTI1-4 interactors ... variety of external stimuli and consist of three sequentially acting protein kinases: a MAPK kinase kinase, a MAPK kinase (MAPKK) and ﬁnally a MAPK [19 ] However, little is known about the function and...

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... lab works image acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are...

Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

... GJ, Hammond SM: A microRNA polycistron as a potential human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, ... HAS2 -A HDAC4 -A HDAC4-B HDAC4-C HDAC4-D HIF1 -A HIF 1A- B IRF1 -A KHDRBS1 -A KHDRBS1-B KPNA2 -A MAP3K8 -A MAP3K8-B MAPK9 -A MYCN -A MYCN-B NCOA3 -A NCOA3-B NCOA3-C NCOA3-D NR 4A3 -A NR 4A3 -B NR 4A3 -C PCAF -A ... additional data are available with the online version of this paper Additional data file is a table listing the G1/S associated mRNAs predicted to be targets of miR-17-5p Additional data file is a figure...

C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription

... AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA CACACTCGAGAAAGATTCCCAGATT ... CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC AATC ... AAAAAGGGAGAGA TCTCTCCCTTTTT AAAAACCCAGAGA TCTCTGGGTTTTT GGGGAGGGAAACC GGTTTCCCTCCCC GGGGACCCAAACC GGTTTGGGTCCCC AGACAAAAAAAGGGAGAGATGAAGGGGG AGGGAAACCGGTTGGTC GACCAACCGGTTTCCCTCCCCCTTCATCTC TCCCTTTTTTTGTCT...

C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... S103 G145/D137 Y 112 D2 01/ 193 L75/67 G145/D137 E1 41/ 133 K173 /16 5 R207 /19 9 G77/69 D142 /13 4 G197 /18 9 Fig Superposition of PRTFDC1 with HPRT-ImmGP (Protein Data Bank code: 1BZY) (A) Residues in the ... Welin et al Studies of the human PRTFDC1 B A PRTFDC1 25 HPRT 20 10 00 0.2 800 600 400 0 .1 200 –50 50 10 10 50 10 015 0 200 250 S 200 –50 250 50 12 00 10 0 15 0 [Hx] (µM) 2.0 PRTFDC1 50 10 0 15 0 200 250 ... 2.0 0 .16 ± 0.02 10 .5 ± 0.9 7.4 · 10 3 ± 1. 9 · 10 3 (0.26%) 2.9 · 10 6 ± 1. 0 · 10 6 (10 0%) 36 .1 ± 14 .3 9.9 ± 0.2 2.9 ± 0.7 899 ± 11 7 1. 36 ± 0.34 406 ± 53 3.9 · 10 4 ± 9.3 · 10 3 (0.09%) 4.5 · 10 7 ± 1. 0...

Báo cáo khoa học: The Rab5 effector Rabaptin-5 and its isoform Rabaptin-5d differ in their ability to interact with the small GTPase Rab4 doc

... therefore used this assay to analyze the interaction of Rabaptin-5d with Rab4 and Rab5 Similarly to Rabaptin-5, Rabaptin-5d was not able to bind Rab4 or Rab5 in the inactive, GDP-bound form as ... Rab4 binding domain, and the region deleted in Rabaptin-5d are numbered according to the amino acid sequence of mouse Rabaptin-5 (GeneBank Accession No D86066) Results Rabaptin-5d interacts differentially ... differentially with the small GTPases Rab4 and Rab5 The interaction of Rabaptin-5 with the small GTPases Rab4 and Rab5 can be assessed readily in the yeast two-hybrid system [12,14] We therefore used...

Báo cáo y học: ": Differential splicing of the apoptosis-associated speck like protein containing a caspase recruitment domain (ASC) regulates inflammasomes" doc

... evaluated the capability of the ASC isoforms to interact with caspase Because activation of caspase would result in proteolytic cleavage of the CARD of pro -caspase 1, we expressed the C28 5A catalytically ... article as: Bryan et al., Differential splicing of the apoptosis-associated speck like protein containing a caspase recruitment domain (ASC) regulates inflammasomes Journal of Inflammation 2010, ... Stassinopoulos A, Sagara J, Reed JC: Apoptosis-associated speck- like protein containing a caspase recruitment domain is a regulator of procaspase activation J Immunol 2003, 171:6154-6163 Mariathasan S, Newton...

The role of the small GTPase rab31 in cancer

... overexpression of Rab31 in breast cancer cell lines actually enhanced proliferation [112], Rab31, when elevated in the presence of MUC1-C may enhance instead of retard EGFR signalling in these cells Another ... as the lysosome inhibitor chloroquine increased MUC1-C levels in Rab31 silenced cells How then does Rab31 diminish late endososome-lysosome targeting of MUC1-C while increasing the transport of ... Prognostic role of HuR in hereditary breast cancer Clin Cancer Res 2007; 13: 6959–63 Jin C, Rajabi H, Pitroda S, et al Cooperative interaction between the MUC1-C oncoprotein and the Rab31 GTPase in estrogen...

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

... PDZ -domain- containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to the ... determined the structural and functional properties of the protein protein interaction between v-KIND and MAP2 We deﬁned the binding core regions for the v-KIND–MAP2 interaction and showed that the ... both KIND1 and KIND2; DRasN, deletion of RasN; DGEF, deletion of RasGEF; KIND1, KIND1 domain; KIND2, KIND2 domain (B) KIND2 domain anchors v-KIND to dendrites Flag-tagged v-KIND, DKIND1, DKIND2,...

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

... (2 010 ) 2 611 –2627 ª 2 010 The Authors Journal compilation ª 2 010 FEBS A B Mantsyzov et al 10 11 12 13 14 15 16 17 domain of release factor eRF1 functions in stop codon recognition RNA 6, 12 36 12 47 ... = 10 8 (s )1) Dyy = 10 8 (s )1) Dzz = 10 8 (s )1) s1 = (4Dxx + Dyy + Dzz) )1 (ns) s2 = (Dxx + 4Dyy + Dzz) )1 (ns) s3 = (Dxx + Dyy + 4Dzz) )1 (ns) 0 .10 2 0 .12 5 0 .14 0 14 .86 13 .48 12 . 71 0 .10 1 0 .12 8 0 .13 9 14 .90 ... polypeptide chain factors, eukaryotic class polypeptide chain release factor (eRF1) and eukaryotic class polypeptide chain release factor (eRF3) The major functions of eRF1 include recognition of each of...

Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

... Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, ... Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria 2 2 2 2 ... Chromohalobacter salexigens DSM3034 Acinetobacter sp (strain ADP1) Pseudomonas ﬂuorescens Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria...

Báo cáo Y học: The Saccharomyces cerevisiae type 2A protein phosphatase Pph22p is biochemically different from mammalian PP2A potx

... ppa2_pombe PP2Ac_2_A.thaliana Pph3_S .cerevisiae Pph22_S .cerevisiae Pph21_S .cerevisiae ppa1_S.pombe PP2Ac/beta_rabbit PP2Ac/alfa_H.sapiens ppa2_pombe PP2Ac_2_A.thaliana Pph3_S .cerevisiae Pph22_S .cerevisiae ... Pph22_S .cerevisiae Pph21_S .cerevisiae ppa1_S.pombe PP2Ac/beta_rabbit PP2Ac/alfa_H.sapiens ppa2_pombe PP2Ac_2_A.thaliana Pph3_S .cerevisiae Fig Alignment of PP2A from S cerevisiae and other organisms Sequence ... like PP2Ac is eluted with 0.5 M NaCl from the gel (Fig 4D) In order to determine the effect of other polycations on phosphorylase phosphatase activity of yeast and mammalian PP2Ac poly-L-lysine...

Xem thêm

Từ khóa: 9 traversing the dom based on your current context to acquire a new set of dom elements bending moments reactions and thrust due to symmetrical distributed load q within some portion of the arch y 4fx l x 1 l2 tables a 13 a 15 pegylated protein conjugates a new class of therapeutics for the 21st century cav 1 ko mice a new preclinical model to study the role of stromal cav 1 in cancer pathogenesis and progression 3early b cell factor 1 protein structure and function 1 fridrich j a new steganographic method for palette based images proc of the is amp t pics conference april 1998 savannah georgia 1998 285289 it provides with the sampling plans the number of samples to be inspected and the acceptable quality level aql aql 1 5 is applied to very severe inspection on high class expensive item aql 2 5 is applied when textiles of normal good quality are involved iguana dzip1 protein is a novel component of the ciliogenic pathway essential for axonemal biogenesis dev dyn 2010 feb 239 2 527 34 we feeling among the asean states based on table 1 i will a examine the overall state of bilateral relations among the asean states b the degree of regional economic the structure and functions of the red cell membrane macromolecules that carry them the balance of payments is a periodic statement of the which of the following is a correct statement of the second law of thermodynamics preparing students for a new world of work in the 21st century which of the following is a correct statement of newtons second law of motion human creactive protein expression structure and function molecular immunology Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát hiện xâm nhập dựa trên thuật toán k means Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP