pegylated protein conjugates a new class of therapeutics for the 21st century
Báo cáo y học: "Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical pharmacology of C-terminal peptides of SMR1 protein" pptx
Ngày tải lên :
11/08/2014, 03:20
... article as: Mathison et al.: Salivary gland derived peptides as a new class of anti-inflammatory agents: review of preclinical pharmacology of C-terminal peptides of SMR1 protein Journal of Inflammation ... animals [38,48] Oral dosage of feG at 350 μg/kg at the time of OA challenge totally abolished the intestinal anaphylactic reaction and diarrhea in all rats tested In a similar study feG given orally ... endotoxin and that these factors are under the control of the cervical sympathetic nervous system Bioactivity of Salivary Gland Extracts: SGP-T On the basis of the findings that salivary glands participate...
- 11
- 406
- 0
Báo cáo Y học: Endogenous cardiac glycosides, a new class of steroid hormones pot
Ngày tải lên :
24/03/2014, 00:21
... Strophanthus gratus plants and a longknown inhibitor of the sodium pump, has been identified in blood plasma, adrenal glands, and the hypothalamus of mammals The adrenal gland as a source of ouabain The ... Ouabain is also taken up by cultured adrenal cells [28] Consistent with the adrenal gland being a major place of synthesis and/or storage of ouabain, adrenalectomy leads to a lowering of ouabain ... not associated with plasma renin activity [106] The release of ouabain from zona fasciculata cells of the adrenal gland is stimulated via the angiotensin and adrenergic systems, which are intimately...
- 9
- 651
- 0
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx
Ngày tải lên :
28/03/2014, 23:20
... template and the following primers: mm063 2for, 5¢-ATGGTAGGTCTCAAATGATAGGAA ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢ The gene mm0632 was cloned via ... supplementary material is available: Fig S1 SDS ⁄ PAGE analysis of the protein peaks from gel filtration This supplementary material can be found in the online version of this article Please note: As a ... Purification, characterization, and primary structure of a monofunctional catalase from Methanosarcina barkeri Arch Microbiol 171, 317–323 39 Brioukhanov A, Netrusov A, Sordel M, Thauer RK & Shima...
- 10
- 539
- 0
Báo cáo hóa học: "PROJECTION ITERATIVE APPROXIMATIONS FOR A NEW CLASS OF GENERAL RANDOM IMPLICIT QUASI-VARIATIONAL INEQUALITIES" pdf
Ngày tải lên :
22/06/2014, 22:20
... related works, we refer to [2, 4] and the references therein Further, the recent research works of these fascinating areas have been accelerating the random variational and random quasi-variational ... implicit quasivariational inequalities, Journal of Mathematical Analysis and Applications 216 (1997), no 1, 197–210 , Random generalized nonlinear variational inclusions for random fuzzy mappings, ... M A Noor and S A Elsanousi, Iterative algorithms for random variational inequalities, Panamerican Mathematical Journal (1993), no 1, 39–50 [20] A H Siddiqi and Q H Ansari, Strongly nonlinear...
- 17
- 344
- 0
Báo cáo hóa học: " Erratum to “A New Class of Particle Filters for Random Dynamic Systems with Unknown Statistics”" pot
Ngày tải lên :
22/06/2014, 23:20
... in the area of statistical signal processing, and his primary interests are in the theory of modeling, detection, estimation, and time series analysis, and its application to a wide variety of ... with emphasis on the topics of Bayesian analysis, sequential Monte Carlo methods, adaptive filtering, stochastic optimization, and their applications to multiuser communications, smart antenna systems, ... joined Depar´ tamento de Electronica e Sistemas, Universidade da Coru˜ a, where he became an Asn sociate Professor in July 2003 His research interests are in the field of statistical signal processing,...
- 2
- 327
- 0
Báo cáo toán học: "A new class of q-Fibonacci polynomials" pot
Ngày tải lên :
07/08/2014, 07:21
... bad of type a if and ony if u = al bl aj for some l ≥ Let for example n = 10 and u = ababba, then u = ababba = ab1 ab2 ba and therefore ψ(u) = aaaabba The weight of these words is 11 If u = ababaa ... (3.2 ) Remark Formula (3.2 ) has been proved by Shalosh B Ekhad and D Zeilberger [14] with a computer proof and by S O Warnaar [13] as a special case of a cubic summation formula in the form n n(n−1) ... u = ababaa then u is good of type a with length and weight 6, u = a1 ba2 ba Here we get ψ(u) = ψ (a1 ba2 ba) = bbba The weights of the bad words are w(ai−1 bi aj ) = i(3i−1) and w(al bl aj ) =...
- 15
- 300
- 0
Báo cáo y học: "Natural variation of HIV-1 group M integrase: Implications for a new class of antiretroviral inhibitors" pdf
Ngày tải lên :
13/08/2014, 05:21
... were calculated for each pair of mutations JRAND was calculated as the mean Jaccard similarity coefficient after 2,000 random rearrangements of the X or Y vector (containing or for presence or absence ... Young SD: A potent and orally active HIV-1 integrase inhibitor Bioorg Med Chem Lett 2007, 17:1392-1398 Shimura K, Kodama E, Sakagami Y, Matsuzaki Y, Watanabe W, Yamataka K, Watanabe Y, Ohata Y, Doi ... Watanabe W, Yamataka K, Sato M, Kano M, Ikeda S, Matsuoka M: In vitro antiviral activity and resistance profile of a novel HIV integrase inhibitor JTK-303/GS-9137 ICAAC 2006 Low A, Mohri H, Markowitz...
- 11
- 455
- 0
Báo cáo y học: " A new modality of treatment for non-united fracture of the humerus in a patient with osteopetrosis: a case report" pptx
Ngày tải lên :
11/08/2014, 19:21
... decided for the fracture of the humerus under general anaesthesia (GA) and axillary block A delto-pectoral approach was used to expose the fracture The bone ends were found to be bleeding satisfactorily ... and withdrawn for cleaning A standard 3.2 mm drill was used to attain the right diameter A plate of sufficient length was used to reach beyond the area of the stress line It was possible to achieve ... informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of...
- 3
- 298
- 0
Development of a new elastic path controller for the collaborative wheelchair assistant
Ngày tải lên :
11/09/2015, 09:59
... providing a guide path and that the driving performance of the elastic mode NATIONAL UNIVERSITY OF SINGAPORE SINGAPORE SUMMARY viii is comparable to that of the constrained mode The drawback of the ... approach The deliberative and reactive approaches have complementary characteristics such that the merits of one approach can compensate for the drawbacks of the other In order to bridge the gap ... mobility tasks of the CWA 1.5 Organization of Thesis The thesis is organized as follows: Chapter introduces the background of CWA and the EPC Three central problems are put forward related to the path...
- 160
- 310
- 0
Strength of materials a new unified theory for the 21st century
Ngày tải lên :
09/03/2016, 10:23
... and displacement as the simultaneous unknowns The total formulation considers force, displacement, and deformation as the primary variables For the sake of completeness the analysis methods are ... given for the analysis of indeterminate structures Treatment of initial deformation by the IFM is straightforward because it is a natural parameter of the compatibility condition: as load is ... moment is a stress resultant (M szdA), here s is the axial stress, z is the distance from the neutral axis, and A is the cross-sectional area of the beam The shear force 18 STRENGTH OF MATERIALS...
- 773
- 822
- 0
A POPULAR HISTORY OF ASTRONOMY DURING THE NINETEENTH CENTURY pot
Ngày tải lên :
28/03/2014, 15:20
... an idea of the arduous nature of this task It involved the formation of a theory of the errors of each of Bradley's instruments, and a difficult and delicate inquiry into the true value of each ... India Company at Madras, Bombay, and St Helena, during the first third of the nineteenth century The organisation of astronomy in the United States of America was due to a strong wave of popular ... parallax, however, the case was very different The search for it had already led Bradley to the important discoveries of the aberration of light and the nutation of the earth's axis; it was now about...
- 663
- 438
- 1
báo cáo hóa học:" Research Article A New Conservative Difference Scheme for the General Rosenau-RLW Equation" pot
Ngày tải lên :
21/06/2014, 11:20
... Numerical results of all the schemes are very good Hence, we propose a new conservative difference scheme for the general Rosenau-RLW equation, which simulates conservative laws 1.4 and 1.5 at the same ... various steps of τ and h at t 60 for p 2, and The three tables verify the second-order convergence and good stability of the numerical solutions Tables 4, 5, and shows the conservative law of ... the proof of Theorem 2.10, we have Wn n Wx n Wxx 2.39 This completes the proof of Theorem 2.11 Remark 2.12 All results above in this paper are correct for initial-boundary value problem of the general...
- 13
- 360
- 0
Báo cáo y học: "A critical appraisal of guidelines for the management of knee osteoarthritis using Appraisal of Guidelines Research and Evaluation criteria" doc
Ngày tải lên :
09/08/2014, 10:22
... data, and in the revision of the manuscript All authors read and approved the final manuscript SP additionally drafted the manuscript Acknowledgements The authors are grateful to the Laboratoires ... purposes) Arthritis Research & Therapy Vol No Poitras et al Table Domain scores and overall assessment of the guidelines Appraisal of Guidelines Research and Evaluation domain EULAR [6] Ottawa Panel ... work of the Appraisal of Guidelines Research and Evaluation (AGREE) collaboration, an 'international collaboration of researchers and policy makers working together to improve the quality and...
- 12
- 465
- 0
A new singular s FEM for the linear elastic fracture mechanics
Ngày tải lên :
09/09/2015, 18:57
... s Area of smoothing domain k Aks , a Area of sub-smoothing domain AJ Area path around the crack to calculate J-integral parameter b Vector of external body forces B I ( x) Compatible strain ... model for the failure of brittle materials, justifying singular behavior of analytical stress around the crack tip A modified form of the Griffith’s approach for the linear elastic fracture mechanics ... overly-stiff property of FEM The new ideas of present study may have significant impact on both accuracy and computational efficiency compared to the available approach of singular FEM for fracture problems...
- 223
- 363
- 0
Introduction of Neuroethics Challenges for the 21st Century
Ngày tải lên :
01/11/2013, 09:20
... Adams and Aizawa not claim that mental states are necessarily internal to the skull Instead, they argue, as a matter of fact all actual mental states of human beings are internal (Adams and Aizawa, ... are to avoid an infinite regress, Adams and Aizawa argue, we must recognize that human minds are capable of states that are intrinsically referential When I read CAT, I have a mental state that ... mind hypothesis have been those advanced by Adams and Aizawa (2001) and Rupert (2004) Adams and Aizawa argue that in order to assess the claim that something counts as properly part of the mind,...
- 68
- 571
- 0
Báo cáo y học: " Frontiers of Oncology: Biobanking Resources for the 21st Century" docx
Ngày tải lên :
10/08/2014, 09:22
... future of translation; the development and maintenance of the Centers for Translational Science will be critical to this future as will the execution of plans for the National Center for Advancing ... TCGA is to improve our ability to diagnose, treat and prevent cancer via full molecular characterization of more than 20 cancer types RNA and DNA from the same set of tumor and matched normal samples ... powerful markers leading to robust patient stratification as the quality of biobanks and their annotations and the technologies used to acquire these data improve Some of the important next steps...
- 3
- 223
- 0
Automated, creative and dispersed the future of work in the 21st century
Ngày tải lên :
04/12/2015, 00:05
... organisations Here, the insight of another expert interviewee reveals a way forward For Professor James Baron of the Yale School of Management, the key trend impacting the future of work is the change ... through automation,” explains Hans Tesselaar, director of sourcing, innovation and governance at Dutch bank ING (see The bank of the future”, page 16) All this automation is already changing the capabilities ... way to attract top talent” But there is also “much more than salary that matters to people”, explains Tina Oakley, HR director at Gatwick Airport Staff often look at a company’s values and the...
- 32
- 408
- 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf
Ngày tải lên :
14/03/2014, 23:20
... CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT ... AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG PPP6C-siR-Bottom PPP6C-forward PPP6C-reverse 2052 FEBS Journal 278 (2011) ... complementary; therefore, they function through translational repression rather than cleavage [5] On the basis of this, miRNAs could control as many as 30% of all protein- coding genes [6] MicroRNAs play...
- 11
- 396
- 0
Báo cáo y học: " Characterization of a new 5'''' splice site within the caprine arthritis encephalitis virus genome: evidence for a novel auxiliary protein" pot
Ngày tải lên :
13/08/2014, 06:20
... sitedirected mutagenesis at position 5979, upstream the env initiation codon, using the primer 5'-TGCAAATAAATGGATCCAACAAGTAGCAAAAGT-3' (nt 5968 to 6000) Mutagenic primers 5'-GGGACAGCAAGCTAAGTATCAA3' (nt ... were Mar52 (5'-TAATCTGTGCAATACCAGAGCGGCT-3'; nt 131 to 155; forward primer) and M3b Primer pair MarN (5'-CAGCAAGGTAAGTATCAACCCCAG-3'; nt 6117 to 6140; forward primer) and M3b was used in a second ... post-translational modifications or protein degradations, the rtm cDNA was used as a template in an in vitro transcription-translation reaction As shown in Fig 3D, analysis of the cell-free radiolabeled...
- 17
- 422
- 0