0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

... mouse, Fugu, and zebrafish 63 -64 3.5 Assembled sequences of irf6 genomic fragments 64 -66 3 .6 The irf6 gene locus on the LG22 in T51 RH panel and in the Ensembl zebrafish version (ZV6) 68 -69 3.7 Whole-mount ... morpholinos 85 3.14 Loss of irf6 function phenotypes 86- 87 3.15 Comparison of expression of molecular markers in irf6 morphants and wildtype 91-92 3. 16 Hematoxylin and eosin staining of intestines ... MOLECULAR CHARACTERIZATION AND DEVELOPMENTAL ANALYSIS OF INTERFERON REGULATORY FACTOR (IRF6) GENE IN ZEBRAFISH BEN JIN (M.Sc., National University of Singapore) A THESIS SUBMITTED...
  • 149
  • 297
  • 0
Molecular characterization and developmental analysis of the TGF beta 3 gene in zebrafish

Molecular characterization and developmental analysis of the TGF beta 3 gene in zebrafish

... mutants, trunk notochords are present.  This shows that spt mutation can suppress the 35   Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish flh  mutation,  suggesting  that  in the midline,  flh  is  involved  in promoting  ... Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish phosphorylating  TβR­I  on  the serine  and threonine  residues  and thus  results  in the activation of TβR­I.  In addition, the TβR­II kinase domain can also phosphorylate itself.  ... the molecule to the membrane of the early endosomes.  The efficient recruitment of the Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish Smad 2 and Smad 3 to the activated receptors for phosphorylation is facilitated by these ...
  • 173
  • 305
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

... GTCCACATCAACGGCCGCCGGCTCG AGCCAACAGACACTCCTGTGTTCC CATGCCAGACCCTGATATTATCACC ACCTACACCAATGTCACCTGGAC GTGCCACACCTACTATGACCACAG TCAAGCCTCCAAACCAAGCC TGGCGGTCCATAAATGAGGTG TATGCAGCTTTGGCAATTCCC TTGATCTTTAGCAACTGTATCTG ... TGGTGGAGGCCTGTTCAGAGC CCAAGTTGTGGGCTGTCAACAC CAGAGTCCTCCTGGTGGACATTC ATTACCAAGCGCAACGCTAGGC CATGTGGCCAACATGTGTG TGATTTGGTCAAGGTAGCC CCTTCTACAACACCAAATGATTGCC AGGCCAGGATGTCAACACTGGCAC ATGTATGGATAGCCCTCAGATTG ... Decaro N, Corrente M, Elia G, Cavalli A, Radogna A, Costantini V, Saif LJ, Lavazza A, Di Trani L, Buonavoglia C, Cavalli A, Radogna A, Costantini V, Saif LJ, Lavazza A, Di Trani L, Buonavoglia...
  • 10
  • 401
  • 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2 (data not ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are...
  • 8
  • 465
  • 0
Báo cáo khoa học: Genomic structure and expression analysis of the RNase j family ortholog gene in the insect Ceratitis capitata pptx

Báo cáo khoa học: Genomic structure and expression analysis of the RNase j family ortholog gene in the insect Ceratitis capitata pptx

... organization of the ORF region of the RNase j family genes is shown in Fig 7A In all organisms examined, the region coding for RNase j is interrupted by two introns, with the exception of the sea urchin ... describe the expression profile of the RNase j gene at various developmental stages and in several tissues of the insect C capitata We have also determined the general genomic organization of this gene ... analysis of the Cc RNase ment with the terminal sequences of the longer transcript was amplified by PCR and the RNase j gene structure was determined The C capitata RNase j gene consists of three...
  • 11
  • 479
  • 0
Molecular characterization and developmental expression patterns of the zebrafish twist gene family

Molecular characterization and developmental expression patterns of the zebrafish twist gene family

... pattern with other species 83 4.5.1 Zebrafish twist1 a and twist1 b genes 83 4.5.2 Zebrafish twist2 85 4.5.3 Zebrafish twist3 86 4.6 Shared and unique expression sites of the zebrafish twist genes 86 ... proteins generated by the neighbor-joining method Figure 3.6: Gene structure of twist1 a, twist1 b, twist2 and twist3 Figure 3.7: RT-PCR of zebrafish twist genes Figure 3.8: Expression of zebrafish twist ... medaka, and human twist genes showed that the zebrafish twist1 a and twist1 b are coparalogs and co-orthologs of human TWIST1 Furthermore, zebrafish twist1 a and twist1 b are orthologous to medaka twist1 a...
  • 115
  • 260
  • 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... to their positions The arrowheads depict the residues important for the structural core of the IL-10 gene The underlined amino acid residues are the signal sequences of the respective genes The ... conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investigated This work will pave the way for further investigation of the biological function of ... Fig Hydropathy plot of putative IL-10 proteins from carp, torafugu and human The x-axis denotes the residue position and the y-axis represents hydrophobicity The hydrophobicity analysis was carried...
  • 8
  • 584
  • 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... The histamine releases were measured by an enzyme immunoassay (Immunotech) After subtraction of the spontaneous release of the basophils, the allergeninduced histamine release was calculated as ... self-prepared tomato extract, nLyc e 2, rLyc e 2, horseradish peroxidase, deglycosylated horseradish peroxidase, the glycopeptide MUXF and MUXF conjugated to BSA as well as BSA alone were used ... SDS/PAGE analysis of electroeluted recombinant Lyc e isoforms rLyc e 2. 01 (lane 1) and rLyc e 2. 02 (lane 2) , Coomassie stain M, molecular mass marker reacted with the recombinant protein in the ELISA,...
  • 11
  • 533
  • 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

... pattern of expression of a gene [34–39] To evaluate the relevance of the leader intron in cardosin expression, we deleted it from the 5¢-flanking region of the genes (Fig 8) The deletion of the cardosin ... region of the cardosin B gene (from ) 147 bp to + 238 bp) .The 529 bp of the promoter region of the cardosin A gene that is relevant for gene expression in Arabidopsis and the corresponding region of ... of cardosin A, B and D genomic clones with the respective cDNAs (Fig 2) revealed the presence of an intron in the 5¢-UTR of the genes The nucleotide sequences of the cDNA and genomic clones of...
  • 17
  • 359
  • 0
Báo cáo y học:

Báo cáo y học: " Complete coding sequence characterization and comparative analysis of the putati" docx

... drafted the manuscript SP and KS participated in the sequence alignment PL and YP participated in the design of the study and performed the data statistical analysis YP conceived of the study in ... only 64% sequence identity with the other HRV-Cs HRV-CU072 coding sequence analysis To investigate the molecular characteristics of the putative new HRV-C strain, we performed comparative analysis ... compatibility matrix (PCM) analysis is a computational method used to investigate the phylogenetic relationship of the sequences to be analyzed The PCM plot of nucleotide sequence alignment in intraand...
  • 12
  • 456
  • 0
báo cáo khoa học:

báo cáo khoa học: " Characterization and structural analysis of wild type and a non-abscission mutant at the development funiculus (Def) locus in Pisum sativum L" pdf

... and attachment of pea seeds to the replum in a pod of the def mutant pea The def mutant pea shows a swollen and thick funicle compared to the wild type Arrows indicate the AZ and ALZ in the wild ... growing of the plants, harvested materials, carried out the structural examination and drafted the manuscript YKL participated in designing the experiments, structural analysis and the drafting of the ... pea seed at stage 8.1 and (B) In mature pea seed at 2.1 (C) Higher magnification of the AZ development in the young pea seed in (A) (D) Higher magnification of the AZ in the mature pea seed in...
  • 7
  • 372
  • 0
Characterization and performance analysis of bifacial solar cells and modules

Characterization and performance analysis of bifacial solar cells and modules

... applications and challenges with bifacial solar cells and modules 10 Background 10 2.1.1 Bifacial solar cells and module structures 10 2.1.2 History of bifacial solar cells and modules ... solar cells and modules This thesis focuses on characterisation and standardisation of bifacial solar cells and modules, and on performance evaluation of these devices in indoor and outdoor environments ... increase the market share of bifacial solar cells and modules The development of robust characterisation techniques and standard tests for bifacial solar cells and modules is important for two...
  • 179
  • 945
  • 0
Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 1

Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 1

... et al., 19 99) 10 0! Table 13 : Changes to ID2 protocol for expression and purification of ID2 and ID3 mutants 10 3! Table 14 : ID1 & ID2 constructs and their theoretical biochemical ... al., 19 90, Biggs, et al., 19 92, Christy, et al., 19 91, Riechmann, et al., 19 94, Sun, et al., 19 91) The mammalian family consisted of four members, namely ID1, ID2, ID3 and ID4 (Norton, 2000) and ... al., 19 99) 10 4! Table 15 : Changes to ID2 protocol for expression and purification of ID1 and ID3 HLH domains 10 4! ! vi! LIST OF FIGURES Figure 1: Hydrophobic core packing of...
  • 30
  • 305
  • 0
Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 2

Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 2

... cDNA (bp) AA start AA end #AA pI MW (kDa) 4 02 177 24 6 339 21 9 28 8 Construct 24 1 24 134 82 82 113 82 82 134 59 82 113 73 96 7.8 6.1 8.8 9 .2 6.1 8.8 14.9 6.8 9.3 12. 7 8.3 10.8 Full Length HLH24- 82 ... structure of ID2 3) Analyze the structure of ID2 and look at similarities and differences to other HLH-containing proteins including ID3 ! 20 ! 4) Determine differences in binding between ID1, ID2 and ... (lane S) at 17°C, HLH24- 82- L insoluble (lane P) at 30°C, HLH24- 82- L soluble (lane S) at 30°C, HLH24- 82- L insoluble (lane P) at 17°C, HLH24- 82- L soluble (lane S) at 17°C, N-HLH113 insoluble (lane...
  • 19
  • 292
  • 0
Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 3

Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 3

... marker (lane M, kDa) N-HLH82-L (gel A, lane 1), HLH24-82-L (gel B, lane 2), HLH24-82-L-Se-Met (gel C, lane 3) ! 38 ! 3. 3 Protein Identification The purified samples were excised from the gel and analyzed ... SILSLQASEF PSELMSNDSK ALCG Match to: Q53H99_HUMAN Score: 17248 Inhibitor of DNA binding variant (Fragment).- Homo sapiens (Human) Found in search of C:\Documents and Settings\Administrator\Desktop\Marie\1D2_BHLH.RAW ... expression and purification (A) Elution profile of nickel-bead affinity and desalting chromatography (B) SDS-PAGE: marker (lane 1), sample before induction (lane 2), pooled desalted fractions (lane 3) ,...
  • 5
  • 253
  • 0

Xem thêm

Từ khóa: human gm km and am allotypes and their molecular characterization a remarkable demonstration of polymorphismmolecular and genetic analysis of the drosophila model of fragile x syndromefunctional and bioinformatic analysis of cloned maize c4 and arabidopsis c4 like ppdk regulatory proteina syntactic and semantic analysis of turkish nominal compoundsa syntactic semantic and pragmatic analysis of conjunctionstructural and chemical analysis of materialssubjectivity and sentiment analysis of arabic a surveysubjectivity and sentiment analysis of modern standard arabicdifference between syntactic and semantic analysis of nlpcash flow statement and ratio analysis of tata motorsstructural and chemical analysis of materials pdfspeech act theory and the analysis of conversationsthe aim theory and the analysis of the electron densitymolecular biology and biological functions of endothelindesign and fe analysis of a 150 kw machinechuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ