Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. Ram Savan 1 , Daisuke Igawa 2 and Masahiro Sakai 2 1 United Graduate School of Agricultural Sciences, Kagoshima University, Korimoto, Japan; 2 Faculty of Agriculture, Miyazaki University, Miyazaki, Japan Interleukin (IL)-10 was cloned from the common carp (Cyprinus carpio L.) using IL-10 primers from carp head kidney following stimulation with concanavalin A and lipopolysaccharide. The cDNA consisted of a 1096 bp se- quence containing a 55 bp 5¢ untranslated region and a 498 bp 3¢ untranslated region. An open reading frame of 543 bp encoded a putative 180 amino acid protein with a putative signal peptide of 22 amino acids. The signature motif of IL-10 is conserved in carp sequence. A 2083 bp genomic sequence of carp IL-10 was found to contain five exons interrupted by four introns. With the exception of much more compact introns, the genomic structure was similar to that of mammalian IL-10. By homology, phylo- geny and genomic analyses, the carp gene cloned was des- ignated as IL-10. Carp IL-10 was expressed in head, kidney, liver, spleen and intestine during the resting phase. The gene was also expressed in head kidney and liver following in vitro stimulation with lipopolysaccharide. Keywords: cytokines; interleukin; innate immunity; fish; expression analysis. Cytokines play a significant role in initiating and regulating the inflammatory process, which is an important defense system in innate immunity. Cytokines are subdivided into families such as interleukins (ILs), lymphokines, growth factors, interferons (IFNs) and chemokines. IL-10, initially known as cytokine synthesis inhibitory factor, is a multi- functional cytokine and demonstrates immunosuppressive function. The main function of IL-10 seems to be regulation of immunity and the inflammatory response, thereby minimizing damage to the host induced by response to a pathogen or by the self-immune system. IL-10 inhibits the activation of macrophages/monocytes, thereby inhibiting cytokine synthesis, nitric oxide (NO) production and the expression of other costimulatory molecules. Apart from IL-10 [1], a host of IL-10 family members such as IL-19 [2], IL-20 [3], IL-22 [1], IL-24 [4] and IL-26 [5], have been reported. Several IL-10 viral homologues have also been reported [6], which mimic the activities of IL-10, suppressing the immune system of the host to facilitate its survival [7]. As innate immunity is known to be important in the defense of pathogens, isolation and characterization of cytokines is of prime importance. Only a few cytokines and chemokines are known in fish, where they have been cloned either by expressed sequence tag (EST) analysis or by PCR- mediated homology cloning. Among the cytokines, CC [8,9] and CXC [10] chemokines, IL-1b [11], tumor necrosis factor-a [12], transforming growth factor [13,14], IL-8 [15] andIFN[16],haveallbeenclonedinfish. Recently, IL-10 homologues from torafugu (Taki- fugu rubripes) and spotted green puffer fish (Tetraodon nigroviridis) have been submitted to the EMBL database (accession numbers CAD62446 and CAD67773), facilita- ted by the fugu sequencing project [17]. However, expres- sion of IL-10 has not been reported in fish. This is the first report of an investigation of the expression patterns of IL- 10 in fish, in different tissues and its inducibility, when stimulated with lipopolysaccharide (LPS). The presence of IL-10 in fish gives significant insight on the regulation of the immune response in fish. By homology, phylogeny and genome analyses, the carp gene cloned was confirmed as IL-10. Materials and methods Fish Common carp (mean weight 100 g) was obtained from Sunaso fisheries farm (Miyazaki, Japan). The fish were acclimatized in an aerated fresh water tank at 20 °C, under a natural photoperiod, and fed for 2 weeks, prior to use in the study. Cloning and characterization of the carp IL-10 gene A carp cDNA library, produced following stimulation with concanavalin A and LPS [18], was used to isolate the IL-10 gene, employing IL-10-Fw2 and IL-10-Rv2 primers (Table 1), which were designed based on the conserved regions of puffer fish and mammalian IL-10. PCR was performed using a PTC-200 (MJ Research, Waltham, MA, USA) with 30 reaction cycles of: 30 s at 94 °C, 30 s at 58 °C Correspondence to M. Sakai, Faculty of Agriculture, Miyazaki University, Gakuen kibanadai nishi 1-1, Miyazaki 889-2192, Japan. Fax: + 81 985 587219, Tel.: + 81 985 587219, E-mail: m.sakai@cc.miyazaki-u.ac.jp Abbreviations: EST, expressed sequence tag; IFN, interferon; IL, interleukin; LPS, lipopolysaccharide; NO, nitric oxide; UTR, untranslated region. (Received 7 August 2003, revised 16 September 2003, accepted 25 September 2003) Eur. J. Biochem. 270, 4647–4654 (2003) Ó FEBS 2003 doi:10.1046/j.1432-1033.2003.03854.x and 3 min at 72 °C, with a final extension for 7 min at 72 °C. Genomic DNA was isolated from carp liver using a formamide method, described previously [19]. PCR was performed with 2 lL (500 ng) of template genomic DNA using primers IL-10-Fw2 and IL-10-Rv2 (Table 1). After an initial denaturation at 94 °C for 5 min, PCR cycling was carried out (for 10 cycles) as follows: 10 s at 94 °C, 30 s at 57 °C,and2minat72°C. Amplification was carried out for 20 cycles of the same temperature profile, but with an increased holding time of elongation (3 s per cycle). A final delay was allowed for 7 min at 72 °C. PCR products were electrophoresed on a 1.5% (w/v) agarose gel for detection of the specific bands. All PCR reactions were performed according to the following protocol: 5 lLofdNTPs(10l M of each dNTP), 0.5 lLofExTaq polymerase (5 UÆmL )1 ; Takara Bio Inc, Japan), 5 lL of each gene-specific primer and 27.5 lL of water. The products obtained were cloned into the PGEM-T Easy vector (Promega, USA) and transformed into JM109 by electroporation (BTX 399; Genetronics, San Diego, CA, USA). Sequence and phylogenetic analyses The sequences were compared with those in the database by using the BLASTX algorithm [20]. The signal sequences were predicted using the SIGNAL IP program. Protein alignment and percentage identities were calculated by CLUSTAL W using BIOEDIT software [21]. Hydropathy analyses of carp, torafugu and human IL-10 amino acid sequences were carried out [22]. Phylogenetic analysis was carried out for the deduced amino acid sequences of carp and other IL-10 homologues. Phylogenetic trees were obtained by the neighbor joining method, with 1000 replications to obtain Bootstrap values, using PAUP software [23]. IFN-c was used as an outgroup in this analysis. Expression of the IL-10 gene Analysis of IL-10 gene expression in healthy tissues by RT–PCR. Total RNA extracted from the cell suspension of organs isolated from healthy carp were used for cDNA synthesis by ReverTra Dash (Toyobo, Osaka, Japan). Gene specific primers IL-10-Fw3 and IL-10-Rv3 (Table 1) for IL- 10 amplification were designed using highly conserved regions, and amplified product gave a specific product of 284 bp. A set of b-actin primers (forward: 5¢-ACTACCTCATGAAGATCCTG-3¢ and reverse: 5¢-TTGCTGACCACATCTGCTG-3¢) served as a control for the quantity and quality of cDNA. Semiquantitative analysis of RT–PCR products. Suspen- sions of Carp head kidney and liver cells were treated with 10 lgÆmL )1 LPS for 1, 3 and 6 h, individually, in RPMI- Table 1. Primers used in this study. Primers Sequence (5¢)3¢) IL-10 forward2 GACTGTTGCTCATTTGTGGA IL-10 reverse2 GAGGCTAGATACTGCTCGATGT IL-10 forward3 TGATGATTTGGAACCATTATTGAA IL-10 reverse3 CACCTTTTTCCTTCATCTTTTCAT b-Actin forward1 ACTACCTCATGAAGATCCTG b-Actin reverse1 TTGCTGATCCACATCTGCTG T7- forward TAATACGACTCACTATAGGG SP6-reverse ATTTAGGTGACACTATAGAA Fig. 1. Genomic sequence structure of carp IL-10. Coding sequences are shown in uppercase, whereas the untranslated region (UTR) and introns are shown in lower case. Intron splice sites (gt or ag) are shown in italics. The deduced amino acid sequence is given below the nucleotides. The motifs associated with mRNA instability are shown in bold and the polyadenylation signal in bold italics. The stop codon is represented with an asterisk. 4648 R. Savan et al. (Eur. J. Biochem. 270) Ó FEBS 2003 1640 supplemented with 10% carp serum and 1% strepto- mycin/penicillin. Controls of the same cells were incubated for 0, 1, 3 and 6 h in identical medium but without LPS. Total RNA extracted from cells after culture was used for cDNA synthesis (ReverTra Dash; Toyobo).Semiquantita- tive analysis was carried out according to the method described by Laing et al. [24]. In order to adopt a more semiquantitative approach for analysing IL-10 gene expres- sion, both carp IL-10 and b-actin genes were amplified using a range (21–30) of PCR cycles. Following this procedure, an optimal number of PCR cycles (24 for IL-10 and 21 for b- actin) was determined and subsequently employed in the above expression analysis. The carp IL-10 gene/b-actin ratio was determined by densitometry, performed by measuring the photo-stimulated luminescence values using SCIENCE LAB 99 IMAGE GAUGE software (Fujifilm, Tokyo, Japan) and by comparing the carp IL-10 transcript levels with those of b-actin. PCR conditions All PCR reactions were performed according to the following protocol: 1 lL of cDNA was mixed with 5 lL of dNTPs (10 l M of each dNTP), 10 · Gene Taq Universal buffer, 0.5 lLofTaq polymerase (5 UÆmL )1 ; Nippon Gene, Tokyo, Japan), 5 lL of each gene specific primer (5 l M ), 2 lL of cDNA and 27.5 lL of distilled water. The PCR was performed using a PTC-200 thermal cycler (MJ Research) with predetermined reaction cycles of 30 s at 94 °C, 30 s at 56 °C (IL-10) and 57 °C(b-actin), and 1 min at 72 °C. PCR products were electrophoresed on a 2.0% (w/v) agarose gel to enable detection of the specific bands. Results Cloning of the IL-10 gene from carp By using PCR primers based on the conserved regions of mammalian IL-10 homologues and the torafugu IL-10 genomic sequence, we isolated a clone of 440 bp (resem- bling mammalian IL-10) from carp head kidney cells stimulated with LPS and concanavalin A [18]. The 5¢ and 3¢ termini of the clone were obtained by anchored PCR. This enabled us to clone additional sequences of 145 and 518 bp at the 5¢ and 3¢ ends, respectively. Thus, the fully cloned carp IL-10 cDNA consisted of a sequence of 1096 bp comprising a 55 bp 5¢ untranslated region (UTR), a 543 bp open reading frame encoding an 180 amino acid peptide, and a 498 bp 3¢-UTR (Fig. 1). The 3¢-UTR contains two ÔATTTAÕ inflammatory motifs compared with five such segments in human IL-10 and contains a single typical polyadenylation signal (AATAAA) between nucleotides 1074–1079. The predicted cleavage site of the signal sequence to the mature protein is between Gln21 and Cys22 (Fig. 2). The putative carp IL-10 is an 18 000 molecular mass polypeptide with a pI of 7.89. A similar Fig. 2. Alignment of the deduced amino acid sequence of carp IL-10 with other homologues in pufferfish and mammalian counterparts. Identical amino acid residues are indicated by dashes (–), while dots indicate gaps that have been introduced for optimal alignment. IL-10 signature motifs are shown in the box. The position of A–F helices that has been determined in human IL-10 is shown as a ladder in the alignment. Cysteines from the matured proteins forming disulphide bonds are denoted as numbers relative to their positions. The arrowheads depict the residues important for the structural core of the IL-10 gene. The underlined amino acid residues are the signal sequences of the respective genes. The asterisk indicates the residues important for an interaction with the IL-10R/R1 receptor chain. The accession numbers of the IL-10 sequences used in the alignment are as follows: human, NP_000563; cat, AAC64708; rat, CAA43090; mouse, A34853. Ó FEBS 2003 Cloning and analysis of IL-10 in fish (Eur. J. Biochem. 270) 4649 hydropathy profile was observed in torafugu and carp IL- 10 sequences (Fig. 3). The sequence is deposited with DDBJ under the accession number AB110780. Genomic structure of carp IL-10 Using the carp primers IL-10-Fw2 and IL-10-Rv2, we amplified a product of 1.4 kbp from carp genomic DNA. A 1403-bp IL-10 genomic sequence was obtained upon sequencing of the cloned product using T7 or SP6 primers (Fig. 1). The carp IL-10 is composed of five exons and four introns, and thus similar to its mammalian counterparts. The exons were positioned exactly to the exons in mammalian IL-10. Typical intron splice motifs were observed at the 5¢ (GT) and 3¢ (AG) ends of each intron. The four introns are 150, 242, 444 and 119 bp in length, respectively. However, while the mammalian counterpart spanned > 5.5 kb, the carp IL-10 was only  2 kb. Structural and phylogenetic analyses of carp IL-10 Alignment of the deduced amino acid sequence of IL-10 with those of mammalian homologues revealed common structural features (Fig. 2). The IL-10 signature sequence motif [KQS]-x(4)-C-[QYC]-x(4)-[LIVM](2)-x-[FL]-[LMV]- x-[DERT]-[IV]-[LMF] is conserved except that the first aminoacidisNreplacedfor[KQS]andMfor[LMV]. Another conserved motif present in the F-helix, KALGEL- DIL, is conserved in carp IL-10 as in other mammalian IL-10 family members. Four conserved cysteine residues in human IL-10 and IL-22 were found to be conserved in carp IL-10. The first cysteine forms a disulphide linkage with the third cysteine found on the D-helix. The second cysteine forms a disulphide bond with the fourth cysteine between the D–E helix. A high degree of conservation is seen around the C-terminal region, especially at the F-helix of the mammalian counterparts. Comparatively high homology was recorded to torafugu (43.2%) and spotted green pufferfish (37.6%). Low sequence identities of  20–28% were observed for mam- malian and viral IL-10 homologues. Very low sequence identity of 12–21% was seen in members of the IL-10 family (Table 2). Phylogenetic analysis was carried out by neighbor joining and the PAUP software (Fig. 4). IFN-c was used as an outgroup, as this gene is structurally related to IL-10. Expression analysis of IL-10 by RT-PCR RT-PCR was used to analyse expression of the IL-10 gene in normal (healthy) tissues of carp (Fig. 5). Using the primers IL-10-Fw3 and IL-10-Rv3 (Table 1), a 284 bp product was obtained from head kidney, spleen, intestine and gill tissues; however, a more pronounced expression of carp IL-10 was observed in head kidney and intestine tissues. A semiquantitative analysis of IL-10 expression in head kidney and liver tissues was carried out using a time course in vitro stimulation with LPS (Fig. 6). A relative increase of IL-10 gene expression was seen at 1 h poststim- ulation and showed a slight decrease at 3 h, producing a low intensity product at 6 h in head kidney. In liver, the IL-10 Fig. 3. Hydropathy plot of putative IL-10 proteins from carp, torafugu and human. The x-axis denotes the residue position and the y-axis represents hydrophobicity. The hydrophobicity analysis was carried out according to the Kyte and Doolittle method [22] using GENETYX software. Table 2. Identities of cellular, viral and family members of interleukin (IL)-10 to the carp gene. Species Accession number Identities to carp IL-10 (%) Overall Mature Torafugu CAD62446 43.2 45.7 Spotted green pufferfish CAD67773 37.6 39.3 Human NP_000563 28.0 26.6 Cat AAC64705 28.5 26.6 Rat CAA43090 25.2 25.1 Mouse A34853 25.2 25.1 Virus IL-10 homologues Human Epstein–Barr virus IL-10 CAA24863 27.4 26.9 Equine herpes virus type 2 IL-10 AAB26148 28.0 26.6 Human cytomegalovirus CAA24863 27.0 25.7 Human IL-10 family members IL-19 AAG16755 18.3 16.0 IL-20 NP_061194 21.9 19.0 IL-22 AAK62468 14.0 13.8 IL-24 AAG41401 12.9 14.3 IL-26 NP_060872 16.9 15.0 4650 R. Savan et al. (Eur. J. Biochem. 270) Ó FEBS 2003 product was present at all time-points of incubation, except for the 0 h control. The highest level of expression was seen at 1 h post-LPS stimulation of liver cells. Discussion IL-10, a helical cytokine, was initially isolated by Mos- mann [25], in humans, and then subsequently in mouse, rat and other mammalian counterparts [26–28]. In the present work we isolated and characterized a carp cDNA sequence that is homologous to the DNA sequence of mammalianIL-10.CarpIL-10is1096bpinlengthand encodes a 180 amino acid protein similar to that of torafugu and mammalian counterparts. Compared with other family members containing the IL-10 gene, human IL-19 and IL-24 encode longer polypeptides of 215 and 206 amino acids, respectively; these polypeptides are longer because they contain an additional in-frame methionine codon upstream as a result of alternative splicing [29]. Carp IL-10 shares a higher similarity to mammalian IL-10 (25–28%), when compared with the other IL-10 family members (16–21%). Spotted green pufferfish IL-20 (AY294560) and IL-24 (AY294560) share identities of 16 and 20% with carp IL-10, which is low when compared with the torafugu IL-10 gene. Phylo- genetic analyses reveal that the carp IL-10 sequence is closer to human and pufferfish (torafugu and spotted green pufferfish) IL-10 sequences. Pufferfish and carp IL-10 genes, clustered together and distant from IL-20 and IL- 24, as recently determined from analysis of the spotted green pufferfish genome, imply that the carp sequence is IL-10. The hydropathy analysis also shows similarity of the torafugu IL-10 sequence to its carp counterpart. These comparisons suggest that carp IL-10 shares many char- acteristics of IL-10 with its family members. The general IL-10 signature sequence comprises a 21 amino acid sequence that is conserved in the carp IL-10 sequence. The first residue in the IL-10 signature sequence is Lys, except for carp, in which it is Asn. The seventh residue is His in all three fish sequences, but Gln in mammals. The second motif (KALGELDL) on the F-helix, which is conserved in all other family members, is conserved in carp IL-10. Regions that form the helices in the human IL-10 sequence show a degree of similarity to the carp IL-10 sequence. The most highly conserved stretch in the IL-10 family is at the C-terminus in the C-helix and at the N- terminus of the F-helix; a similar pattern was also found in carp IL-10. By X-ray crystallographic studies, human and viral homologues of IL-10 are known to have a structure similar to that of IFN-c, i.e. a noncovalent symmetric homodimer that forms V-shaped dimers [30,31]. The monomers are characterized by two disulphide bonds and six a helices. The structurally important cysteine residues, which form the disulphide bonds, are all conserved in carp IL-10. The residues reported to be key in stabilizing the structural core in IL-10 and IFN-c (Leu, Phe, Tyr and Ala), are also strictlyconservedincarpIL-10. Genomic analysis revealed that the carp IL-10 gene contained four introns, which is similar to the human IL-10, IL-20 and IL-26 gene sequences. The intron/exon areas are also conserved in carp IL-10; however, the introns were more compact in carp IL-10 than in its mammalian counterparts. IL-22, IL-19 and IL-24, which are also family members of IL-10, contain five introns. This confirms that the carp gene cloned in this study is, in fact, IL-10, as it has the same intron/ exon structure as human IL-10 (Fig. 7) and shows a higher homology with IL-10 than with IL-20 or IL-26. The presence of the instability motifs are known to influence mRNA half-life and translational efficiency. Fig. 5. Expression patterns of the common carp IL-10 gene from unstimulated organs studied by RT-PCR. b-Actinwasusedasacontrol of the amount and quality of cDNA. Fig. 4. An unrooted phylogenetic tree constructed by the neighbor join- ing method (using PAUP software) from the amino acid sequences of the IL-10 family together with the carp IL-10 gene. The numbers indicate the bootstrap confidence values obtained for each node after 1000 replications. The accession numbers of the sequences used in the alignment are as follows: from humans, Epstein–Barr virus IL-10 (CAA24863), IL-10 (NP_000563), IL-19 (AAG16755), IL-20 (NP_061194), IL-22 (AAK62468), IL-24 (AAG41401), IL-26 (NP_060872) and interferon-a (P01579); from torafugu IL-10 (CAD62446); from spotted green pufferfish IL-10 (CAD 67773), IL-20 (AY294557) and IL-24 (AY294560); and from carp IL-10 (AB110780). Ó FEBS 2003 Cloning and analysis of IL-10 in fish (Eur. J. Biochem. 270) 4651 The carp IL-10 harbored two instability motifs, in comparison to five in human IL-10, in the 3¢-UTR. Whether this difference in the number of instability motifs affects translation needs to be investigated in future studies. LPS induction alone, and costimulation with LPS and IFN-c or IL-13, resulted in expression of the human IL-10 gene. However, when human monocytes were stimulated with LPS (100 ngÆmL )1 ) alone, strong expression was not seen until 2–4 h after stimulation [2]. In our study, we observed IL-10 gene expression in spleen, head kidney, gill and intestine from healthy tissues of carp. When stimulated with LPS, an increase in expression at 1 h poststimulation was recorded in both head kidney and liver. This indicates that the gene is inducible by LPS stimulation. Administra- tion of endotoxin induced IL-10 production in mice, chimpanzees, baboons and humans [32–35]. The presence of endogenous IL-10 confers protection from the lethal effects of endotoxin challenge and reduces the levels of TNF, IFN-c and macrophage inflammatory protein-2 [36]. Although the expression study indicates that this cytokine is involved in the immune response, further experiments on the regulatory mechanisms of carp IL-10 expression and its role in the regulation of other pro-inflammatory genes, such as TNF and IFN, in fish, need to be conducted. In conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investi- gated. This work will pave the way for further investigation of the biological function of this gene, and the probability of the presence of IL-10-related genes in fish, as seen in mammals. Acknowledgements This study was supported, in part, by a grant from the ÔResearch for the Future (JSPS-RFTF 97L00902)Õ program from the Japan Society for the Promotion of Science. References 1. Dumoutier, L., Louahed, J. & Renauld, J.C. (2000) Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9. J. Immunol. 164, 1814–1819. Fig. 7. Schematic representation of IL-10 intron/exon organization together with human IL-10 structure. Boxes are exons and hori- zontal lines are introns, with their nucleotide lengths. Shaded areas represent 5¢ and 3¢ UTRs. Fig. 6. Semiquantitative RT-PCR of IL-10 gene expression by LPS stimulation performed for head kidney and liver. Data are presented as PCR products after normalizing against products of b-actin. The x-axis indicates the time-periods of LPS incubation and the relative expression of the carp IL-10 gene on the y-axis. Controls for 0, 1, 3 and 6 h of incubation without LPS are also shown in the graph. 4652 R. Savan et al. (Eur. J. Biochem. 270) Ó FEBS 2003 2. Gallagher, G., Dickensheets, H., Eskdale, J., Izotova, L.S., Mirochnitchenko, O.V., Peat, J.D., Vazquez, N., Pestka, S., Donnelly, R.P. & Kotenko, S.V. (2000) Cloning, expression and initial characterization of interleukin-19 (IL-19), a novel homologue of human interleukin-10 (IL-10). Genes Immun. 1, 442–450. 3. Blumberg, H., Conklin, D., Xu, W.F., Grossmann, A., Brender, T., Carollo, S., Eagan, M., Foster, D., Haldeman, B.A., Ham- mond, A., Haugen, H., Jelinek, L., Kelly, J.D., Madden, K., Maurer, M.F., Parrish-Novak, J., Prunkard, D., Sexson, S., Sprecher, C., Waggie, K., West, J., Whitmore, T.E., Yao, L., Kuechle, M.K., Dale, B.A. & Chandrasekher, Y.A. (2001) Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell 104, 9–19. 4. Jiang,H.,Lin,J.J.,Su,Z.Z.,Goldstein,N.I.&Fisher,P.B.(1995) Subtraction hybridization identifies a novel melanoma differen- tiation associated gene, mda-7, modulated during human mel- anoma differentiation, growth and progression. Oncogene 11, 2477–2486. 5. Knappe, A., Hor, S., Wittmann, S. & Fickenscher, H. (2000) Induction of a novel cellular homolog of interleukin-10, AK155, by transformation of T lymphocytes with herpesvirus saimiri. J. Virol. 74, 3881–3887. 6. Kotenko, S.V., Saccani, S., Izotova, L.S., Mirochnitchenko, O.V. & Pestka, S. (2000) Human cytomegalovirus harbors its own unique IL-10 homolog (cmvIL-10). Proc. Natl Acad. Sci. USA 97, 1695–1700. 7. Spencer,J.V.,Lockridge,K.M.,Barry,P.A.,Lin,G.,Tsang,M., Penfold, M.E. & Schall, T.J. (2002) Potent immunosuppressive activities of cytomegalovirus-encoded interleukin-10. J. Virol. 76, 1285–1292. 8. Fujiki, K., Shin, D.H., Nakao, M. & Yano, T. (1999) Molecular cloning of carp (Cyprinus carpio) CC chemokine, CXC chemo- kine receptors, allograft inflammatory factor-1, and natural killer cell enhancing factor by use of suppression subtractive hybrid- ization. Immunogenetics 49, 909–914. 9. Kono, T., Fujiki, K., Nakao, M., Yano, T., Endo, M. & Sakai, M. (2002) The immune responses of common carp, Cyprinus carpio L.,injectedwithcarpinterleukin-1betagene.J. Interferon Cytokine Res. 22, 413–419. 10. Savan, R., Kono, T., Aman, A. & Sakai, M. (2003) Isolation and characterization of a novel CXC chemokine in common carp (Cyprinus carpio L.). Mol. Immunol. 39, 829–834. 11. Fujiki, K., Shin, D.H., Nakao, M. & Yano, T. (2000) Molecular cloning and expression analysis of carp (Cyprinus carpio) interleukin-1 beta, high affinity immunoglobulin E Fc receptor gamma subunit and serum amyloid A. Fish Shellfish Immunol. 10, 229–242. 12. Saeij, J.P., Stet, R.J., de Vries, B.J., van Muiswinkel, W.B. & Wiegertjes, G.F. (2003) Molecular and functional characteriza- tion of carp TNF: a link between TNF polymorphism and try- panotolerance? Dev. Comp. Immunol. 27, 29–41. 13. Sumathy, K., Desai, K.V. & Kondaiah, P. (1997) Isolation of transforming growth factor-beta2 cDNA from a fish, Cyprinus carpio,byRT–PCR.Gene 191, 103–107. 14. Zhan, Y. & Jimmy, K. (2000) Molecular isolation and characterisation of carp transforming growth factor beta 1 from activated leucocytes. Fish Shellfish Immunol. 10,309– 318. 15. Najakshin, A.M., Mechetina, L.V., Alabyev, B.Y. & Taranin, A.V. (1999) Identification of an IL-8 homolog in lamprey (Lampetra fluviatilis): early evolutionary divergence of chemok- ines. Eur. J. Immunol. 29, 375–382. 16. Altmann, S.M., Mellon, M.T., Distel, D.L. & Kim, C.H. (2003) Molecular and functional analysis of an interferon gene from the zebrafish, Danio rerio. J. Virol. 77, 1992–2002. 17. Zou,J.,Clark,M.S.&Secombes,C.J.Characterisation,expres- sion and promoter analysis of an interleukin 10 homologue in the puffer fish, Fugu rubripes. Immunogenetics 55, 325–335. 18. Savan, R. & Sakai, M. (2002) Analysis of expressed sequence tags (EST) obtained from common carp, Cyprinus carpio L., head kidney cells after stimulation by two mitogens, lipopolysacchar- ide and concanavalin-A. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 131, 71–82. 19. Sambrook, J., Fritsch, E.F. & Maniatis, T. (2001) Molecular Cloning: A Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 20. Altschul, S.F., Gish, W., Miller, W., Meyers, E.W. & Lipman, D.J. (1990) Basic local alignment search tool. J. Mol. Biol. 215, 403–410. 21. Hall, T.A. (1999) Bioedit: a user friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 41, 95. 22. Kyte, J. & Doolittle, R.F. (1982) A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157, 105–132. 23. Swofford, D.L. (1998) PAUP * Phylogenetic Analysis Using Par- simony (*and Other Methods), 4th edn. Sinauer Associates, Sunderland, Massachussetts. 24. Laing, K.J., Holland, J., Bonilla, S., Cunningham, C. & Secom- bes, C.J. (2001) Cloning and sequencing of caspase 6 in rainbow trout, Oncorhynchus mykiss, and analysis of its expression under conditions known to induce apoptosis. Dev. Comp. Immunol. 25, 303–312. 25. Mosmann, T. (1994) Properties and function of interleukin-10. Adv. Immunol. 56, 1–26. 26.Moore,K.W.,Vieira,P.,Fiorentino,D.F.,Trounstine,M.L., Khan, T.A. & Mosmann, T.R. (1990) Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein–Barr virus gene BCRFI. Science 8, 1230–1234. 27. Vieira, P., de Waal-Malefyt, R., Dang, M.N., Johnson, K.E., Kastelein, R., Fiorentino, D.F., deVries, J.E., Roncarolo, M.G., Mosmann, T.R. & Moore, K.W. (1991) Isolation and expression of human cytokine synthesis inhibitory factor cDNA clones: homology to Epstein–Barr virus open reading frame BCRFI. Proc.NatlAcad.Sci.USA88, 1172–1176. 28. Goodman, R.E., Oblak, J. & Bell, R.G. (1992) Synthesis and characterization of rat interleukin-10 (IL-10) cDNA clones from the RNA of cultured OX8- OX22- thoracic duct T cells. Biochem. Biophys. Res. Commun. 30,1–7. 29. Kotenko, S.V. (2002) The family of IL-10-related cytokines and their receptors: related, but to what extent? Cytokine Growth Factor Rev. 13, 223–240. 30. Zdanov, A., Schalk-Hihi, C., Menon, S., Moore, K.W. & Wlodawer, A. (1997) Crystal structure of Epstein–Barr virus protein BCRF1, a homolog of cellular interleukin-10. J. Mol. Biol. 2, 460–467. 31. Zdanov, A., Schalk-Hihi, C., Gustchina, A., Tsang, M., Weath- erbee, J. & Wlodawer, A. (1995) Crystal structure of interleukin- 10 reveals the functional dimer with an unexpected topological similarity to interferon gamma. Structure 15, 591–601. 32. Pajkrt, D., Camoglio, L., Tiel-van Buul, M.C., de Bruin, K., Cutler, D.L., Affrime, M.B., Rikken, G., van der Poll, T., ten Cate, J.W. & van Deventer, S.J. (1997) Interleukin-10 inhibits activation of coagulation and fibrinolysis during human endo- toxemia. Blood 15, 2701–2705. 33. Durez, P., Abramowicz, D., Gerard, C., Van Mechelen, M., Amraoui, Z., Dubois, C., Leo, O., Velu, T. & Goldman, M. (1993) In vivo induction of interleukin 10 by anti-CD3 mono- clonal antibody or bacterial lipopolysaccharide: differential modulation by cyclosporin A. J. Exp. Med. 177, 551–555. 34. Jansen, P.M., van der Pouw Kraan, T.C., de Jong, I.W., van Mierlo, G., Wijdenes, J., Chang, A.A., Aarden, L.A., Taylor, Ó FEBS 2003 Cloning and analysis of IL-10 in fish (Eur. J. Biochem. 270) 4653 F.B. Jr & Hack, C.E. (1996) Release of interleukin-12 in experimental Escherichia coli septic shock in baboons: relation to plasma levels of interleukin-10 and interferon-gamma. Blood 87, 5144–5151. 35. Marchant, A., Bruyns, C., Vandenabeele, P., Abramowicz, D., Gerard,C.,Delvaux,A.,Ghezzi,P.,Velu,T.&Goldman,M. (1994) The protective role of interleukin-10 in endotoxin shock. Prog. Clin. Biol. Res. 388, 417–423. 36. Standiford,T.J.,Strieter,R.M.,Lukacs,N.W.&Kunkel,S.L. (1995) Neutralization of IL-10 increases lethality in endotoxemia. Cooperative effects of macrophage inflammatory protein-2 and tumor necrosis factor. J. Immunol. 155, 2222–2229. 4654 R. Savan et al. (Eur. J. Biochem. 270) Ó FEBS 2003 . Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. Ram Savan 1 , Daisuke Igawa 2 and Masahiro. detection of the specific bands. All PCR reactions were performed according to the following protocol: 5 lLofdNTPs(1 0l M of each dNTP), 0.5 lLofExTaq polymerase