Sequential effects of a high fat, calorie dense diet or a high fiber diet on gene expression, body weight and associated metabolic responses in c57 BL6J mice

... Plasma insulin levels 42 Plasma leptin levels 43 Statistical analysis 44 iv CHAPTER SEQUENTIAL EFFECTS OF A HIGH- FAT, CALORIE- DENSE DIET ON FOOD INTAKE, BODY WEIGHT, PLASMA LIPIDS, LEPTIN AND GENE ... increasing in both prevalence and severity It is associated with increased risks of type diabetes and cardiovascular disease Increased food intake, particularly a diet high in calories and fat ... the findings on gene expression induced by a high- fat, calorie dense diet could be due to the difference in duration of the feeding period and that the ingestion of the highfat, calorie dense diet...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...

báo cáo khoa học: " Short- and long-term effects of a quality improvement collaborative on diabetes management" pptx

... multifaceted implementation approach emphasizing collaborative learning and exchange of insights and support among a set of healthcare organizations, like a quality improvement collaborative ... albumin, and BMI per patient per year were performed Data about annually foot and eye examinations, consultations with dieticians and podiatrists, and counseling (advice and instruction to monitor ... package of ideas (change concepts) for closing the gap between best and actual practice The package was based on national and international diabetes guidelines, field surveys, personal experience, and...

báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx

... contributions The comparison of test and control groups indicates that bone healing was accelerated by the effect of magnetic fields in all the conditions analyzed; The marked configuration of a bone ... surface On the external surface, its predominantly horizontal and flat direction maintained continuity and shape of the remaining cortical levels Trabecular proliferation was also apparent in a ... outlining the borders of the surgical bone cavity A distance of 1.3 mm separates the washers over the surgical cavity, corresponding to the area where the magnetic field operates P and D mark,...

Báo cáo y học: "Effects of a multi-herbal extract on type 2 diabete" pptx

... Shin TY, Kim HM: Antianaphylactic activity of Poncirus trifoliata fruit extract J Ethnopharmacol 1996, 54:77-84 11 Yamahara J, Yamada T, Kitani T, Naitoh Y, Fujimura H: Antianoxic action and active ... Salicylate-based antiinflammatory drugs inhibit the early lesion of diabetic retinopathy Diabetes 20 07, 56:337-345 26 Kaneto H, Matsuoka TA, Nakatani Y, Kawamori D, Miyatsuka T, Matsuhisa M, Yamasaki ... fractions Conclusion The aqueous extract of these seven hypoglycemic herbs demonstrated anti-diabetic effects on type diabetes Abbreviations ACS: acyl-CoA synthetase; AICAR: aminoimidazole carboxamide...

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... were all effective methyltransferase inhibitors Only AMI-1 and AMI-6 demonstrated selectivity for the PRMTs, although AMI-6 was minimally active against a cellular PRMT substrate [8] Computational ... K Bonham et al 11 Clarke SG (2006) Inhibition of mammalian protein methyltransferases by 5¢-methylthioadenosine (MTA): a mechanism of action of dietary SAMe? In The Enzymes: Protein Methyltransferases...

Báo cáo khoa học: Exosites mediate the anti-inﬂammatory effects of a multifunctional serpin from the saliva of the tick Ixodes ricinus potx

... (2002) Ixolaris, a novel recombinant tissue factor pathway inhibitor (TFPI) from the salivary gland of the tick, Ixodes scapularis: identiﬁcation of factor X and factor Xa as scaffolds for the inhibition ... placed in glass test tubes Radioactivity was measured using a gamma counter (LKB, Wallac, Finland) All animals were maintained and handled according to local and national ethical guidelines Animal ... of leukocyte elastase – and some of its putative physiological activities In this regard, the proinﬂammatory effects of fragments generated from extracellular matrix degradation by elastase are...

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact peptide at t ¼ and t ¼ 60 Binding assays Binding assays were carried ... [33], the peptides containing a b-amino acid substitution in position have increased stability compared to the corresponding a- amino -acid- containing peptides Therefore it is possible to increase peptide ... acid incorporation When Phe7 or Phe8 are replaced by b2-HPhe, the corresponding analogues are weak competitors of speciﬁc NK-1 binding sites These amino acids are in the helical domain of SP which...

Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

... ADAM10 For further confirmation of these findings, we examined the myelination of peripheral nerves in ADAM10 transgenic mice and mice overexpressing dominant negative ADAM10 Because myelination ... Reconstitution experiments with transfection of ADAM10 in ADAM17) ⁄ ) embryonic mouse fibroblasts [55] suggested only a minor influence of ADAM10 on neuregulin-1 shedding, but any positive proof ... For ADAM10 (detection by HA-antibody), one exemplary blot from the brain membrane fraction of four individuals is shown The proform of the proteinase is indicated by a black arrow head and the...

Báo cáo khoa học: and protein bilinear indices – novel bio-macromolecular descriptors for protein research: I. Predicting protein stability effects of a complete set of alanine substitutions in the Arc repressor ppt

... Lẳ1 In addition, the amino acid-type bilinear indices can also be calculated Amino acid and amino acid-type bilinear indices are specic cases of local protein bilinear indices In this sense, the ... be the reason for the lack of linear correlation between protein bilinear indices and stability (tm) for these mutants, leading to a nonlinear dependence between tm and the protein bilinear indices ... using nonstochastic and stochastic bilinear indices in that order These statistical parameters suggest that linear combinations of protein bilinear indices are appropriate for the discrimination...

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

... a GGN4 analogue with both the C-terminal 14 residue truncation and the substitution of the aspartic acid at position 16 by tryptophan, showed antimicrobial activity comparable to that of native ... the GGN4 analogues, including the native GGN4, showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly random-coil conformation with a slight ... perpendicular to the helical axis in panels A and B, and is parallel to the helical axis in panels C and D rapid exchange of the Hz amino protons This observation indicates that the lysine side-chains are...

báo cáo hóa học: "Quality of life in Brazilian obese adolescents: effects of a long-term multidisciplinary lifestyle therapy" pdf

... HKMA; WLP, AP, DAC, LT, JC: data collection, analysis and interpretation of data ST, MTM and ARD: Design and critically revising of the manuscript All authors read and approved the final manuscript ... depression, anxiety, binge eating, body image dissatisfaction, and quality of life in obese adolescents submitted to a multidisciplinary long-term lifestyle therapy Variable Girls Boys Baseline BDI STAI ... performed at the same time of day and at least 15 hours after the last training session in order to avoid diurnal variations Thereafter, obese adolescents started the multidisciplinary lifestyle therapy...

Báo cáo hóa học: " Effects of a robot-assisted training of grasp and pronation/supination in chronic stroke: a pilot stud" pot

... on robot-assisted rehabilitation of the hand, adopting a functional approach based on the combined training of grasping and forearm pronation/supination, two critical functions for manipulation ... who initially presented with minimal pain Robotassisted training may have helped pass a threshold of spontaneous arm use where ADL tasks involving arm and hand are performed at home, thus leading ... to use robot-assisted training that combines grasp and forearm pronation/supination to perform functional tasks With this pilot study, we tested the hypothesis that training the hand using this...

báo cáo hóa học: " The effects of a graduated aerobic exercise programme on cardiovascular disease risk factors in the NHS workplace: a randomised controlled trial" pdf

... 93(2):221-5 Pearson TA, Mensah GA, Alexander RW, Anderson JL, Cannon RO, Criqui M: Markers of inflammation and cardiovascular disease: application to clinical and public health practice: A statement ... benefit of an increase in VO2 max future research should evaluate the implication of a higher intensity workplace exercise training programme on the modification of cardiovascular risk profile, ... time-line of the aerobic exercise training intervention programme Schematic Schematic experimental time-line of the aerobic exercise training intervention programme or afternoon breaks, to avoid...

The effects of a RMB devaluation on ASEAN economies

... that the inclusion of Hong Kong with the PRC implies that the renminbi devaluation is also accompanied by a devaluation of the Hong Kong dollar by the same amount Now the likelihood of Hong Kong ... significant market share in textiles and apparel and other manufactures TABLE Market Share of ASEAN and China in Selected Markets (Asian Crisis Simulation Result) SECTORS USA EU JAPAN ASEAN China ASEAN ... Korea have been much lower In the case of ASEAN the computed average rate of real devaluation is only about 14.3% while it is only 8.8% for Korea TABLE Nominal Devaluation and Rates of Inflation...

Xem thêm

Từ khóa: dynamic effects of a temporary reduction in oil supply in the rest of the world on a small open oil exporter dynamic effects of a temporary increase in liquidity in the rest of the world on a small open oil exporter experimental evaluation of the preventive and therapeutic effects of a moisturizer antioxidant anticancer activity and other health effects of a nutritional supplement galaxy r clinical effects of a robotic gait training the health effects of a psychosocial work stressor effects of a lifestyle intervention effects of a money supply increase effects of a tax 2 effects of query high level features what does the vapor pressure of a pure liquid depend on the vapor pressure of a given liquid depends on vapor pressure of a pure liquid depends on robust nonlinear control of a hypersonic aircraft based on sliding mode control the vapor pressure of a pure liquid depends on which of the following Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP