The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 Christian Freese 1, *, Alistair N. Garratt 2 , Falk Fahrenholz 1 and Kristina Endres 1 1 Institute of Biochemistry, Johannes Gutenberg-University, Mainz, Germany 2 Department of Neurosciences, Max-Delbru ¨ ck-Centre, Berlin, Germany Neuregulin-1 (NRG-1) belongs to a family of growth factors that transduce cellular signals by binding to ErbB receptors [1,2]. At least sixteen different gene products of NRG-1 have been identified [3,4], which display a wide range of functions in the developing as well as in the adult organism. Besides organs such as the heart [5,6] or breasts [7], certain isoforms of NRG-1 mediate important properties in the central and peripheral nervous system: synapse formation [8] and transmission [9], expression of neurotransmitter receptors [10–12] and synaptic plasticity [13]. Addi- tionally, general features of neurones or Schwann cells, such as proliferation, differentiation, migratory processes and regeneration, depend on NRG-1 activity [14–17]. Although some of these functions are restricted to the developing embryonic brain, expression of NRG-1 or at least some of its isoforms [18,19] and the ErbB receptors [13,17,20,21] persists throughout the adult rodent and human nervous system. Within hippo- campal synapses of adult mice, for example, NRG-1b is implicated in activity dependent remodulation by reversing long-term potentiation [22]. Moreover, it induces neurite extension and arborization of primary Keywords Alzheimer; ErbB; metalloproteinase; myelination; shedding Correspondence K. Endres, Institute of Biochemistry, Johannes Gutenberg-University, Johann-Joachim-Becherweg 30, 55128 Mainz, Germany Fax: +49 6131 3925348 Tel: +49 6131 3926182 E-mail: endres@uni-mainz.de *Present address Institute of Pathology, Johannes Gutenberg- University, Mainz, Germany (Received 28 August 2008, revised 22 December 2008, accepted 6 January 2009) doi:10.1111/j.1742-4658.2009.06889.x Although ADAM10 is a major a-secretase involved in non-amyloidogenic processing of the amyloid precursor protein, several additional substrates have been identified, most of them in vitro. Thus, therapeutical approaches for the prevention of Alzheimer’s disease by upregulation of this metalloproteinase may have severe side effects. In the present study, we examined whether the ErbB receptor ligand neuregulin-1, which is essential for myelination and other important neuronal functions, is cleaved by ADAM10. Studies with b- and c-secretase inhibitors, as well as with the metalloproteinase inhibitor GM6001, revealed an inhibition of neuregulin-1 processing in human astroglioma cell line U373; however, specific RNA interference-induced knockdown of ADAM10 remained without effect. In vivo investigations of mice overexpressing either ADAM10 or dominant negative ADAM10 showed unaltered cleavage of neuregulin-1 compared to wild-type animals. As a consequence, the mye- lin sheath thickness of peripheral nerves was unaffected in mice with altered ADAM10 activity. Thus, although the b-secretase BACE-1 acts as a neuregulin-1 sheddase, ADAM10 does not lead to altered neuregulin-1 processing either in cell culture or in vivo. Adverse reactions of an ADAM10-based therapy of Alzheimer’s disease due to neuregulin-1 cleav- age are therefore unlikely. Abbreviations APLP, amyloid precursor-like protein; APP, amyloid precursor protein; APPs, soluble APP fragment; DAPT, N-[N-(3,5-difluorophenacetyl)- L-alanyl]-S-phenylglycine t-butyl ester; NRG-1, neuregulin-1; RNAi, RNA interference. 1568 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS cultures derived from adult murine hippocampi [21]. There is substantial genetic evidence that single nucleo- tide polymorphisms of NRG-1 are associated with the pathogenesis of schizophrenia [23–25]. In addition, NRG-1 has been found to be involved in the patho- genesis of other diseases such as multiple sclerosis [26,27] or breast cancer [7]. How proteins derived from the gene for NRG-1 ful- fil their different functions exactly remains elusive: iso- forms of type I and III exist as transmembrane forms or can be proteolytically processed [8,28–30] to release soluble fragments. It is not known in detail whether the transmembrane protein or its proteolytic products are mainly responsible for the different functions. Because recombinant soluble NRG-1 often is sufficient to induce morphological or biochemical phenotypes [21,31] and shedding of NRG-1 is activity dependent, as shown for electrically stimulated neurones [8], an important role of the cleavage fragments is implicated. The proteinases involved in NRG-1 proteolysis have been partly characterized: cleavage by the amyloid precursor protein (APP)-processing c-secretase [32,33] and, more recently, b-secretase BACE-1 [29,34] was analyzed both in vitro as well as in vivo. Additional data have also been reported with respect to metallo- proteinase-derived proteolysis of NRG-1 isoforms. For example, ADAM19 was shown to participate in NRG-1-b shedding, whereas NRG-1-a2 was not affected by coexpression of this enzyme [35]. Cleavage of the a2 isoform of NRG-1, on the other hand, was impaired in fibroblasts with catalytically inactive ADAM17 [30]. b- and c-secretase are responsible for processing of the Alzheimer associated APP and its paralogues amy- loid precursor-like protein (APLP) 1 and APLP2 [36]. Furthermore, the distribution of NRG-1 and the local- ization of its receptor ErbB4 have been found to be altered in Alzheimer’s disease patients [19,37] and a mouse model of the disease [19]. ADAM10 was found to act as a-secretase in vitro and in cultured cells [38,39]. It competes with BACE-1 for the substrate APP and is able to prevent the formation of Ab pla- ques in a mouse model of the disease [40]. Moreover, ADAM10 restores long-term potentiation and increases cognitive function in transgenic mice [40,41] and enhances cortical synaptogenesis [42]. Due to the overlap of substrate specificity of BACE-1 and ADAM10 with respect to substrates such as APP or the APLPs and partial phenotypic overlap of ADAM10 and NRG-1 knockout mice [43–45], it was considered important to investigate the possible role of ADAM10 in NRG-1 processing in cells and in the living animal. Results Identification of NRG-1 isoforms expressed in the human astroglioma cell line U373 The expression and processing of NRG-1 was described previously in different astroglioma cell lines [31]. Therefore, we chose the human astroglioma cell line U373 to examine the relevance of ADAM10 for NRG-1 shedding. The investigated cell line stably overexpresses the human neuron specific APP isoform 695 to provide an appropriate control substrate for a- as well as b- and c-secretases [39,46]. Recently, sixteen different isoforms of NRG-1 gen- erated by alternative promoter usage, transcription initiation sites or splicing [4,47,48] have been described, and a wide variety of these isoforms are found in brain-derived cell types [49–51]. To charac- terize the isoforms present in the U373 cell line, we performed RT-PCR with domain specific primers [52,53]. Type I as well as type III specific PCR prod- ucts (schematically shown in Fig. 1A: immunoglobu- lin-like domain and glycosylation site or cysteine rich domain sequences) were produced, whereas those characteristic of the type II Kringle domain coding region were not detectable (Fig. 1B). Both a- as well as b-type indicating PCR products were generated. We amplified the juxtamembrane region coding sequence with primers independent of a-orb-type (primers jD_for and TM_rev; Table 1) and subcloned the resulting DNA fragments into pUC19. Sequencing analysis revealed that seven out of eight clones were the a2-type, whereas only one was identified as b2 (for sequences, see Fig. 1B; NM_013964 and NM_13957). Hence, the predominant NRG-1 isoform present in U373 cells is the a2-type with respect to the juxtamembrane region. Because ADAMs such as ADAM10 cleave their substrates in close proximity to the membrane, knowledge of this region of the puta- tive substrate NRG-1 in the investigated cell line was mandatory. On the protein level, the NRG-1 antibody against the C-terminal domain detected a prominent band of approximately 90 kDA in the lysate of U373 cells (Fig. 1C). This is consistent with full length NRG-1 in its glycosylated state [31] for a panel of glioma cells. Protein bands with a higher molecular weight might indicate the immature proform and the band with a reduced molecular weight might represent an incom- pletely glycosylated intermediate. Additionally, between 40 and 50 kDa, two C-terminal fragments were detectable. After serum free incubation of cells for 4 h, a band of approximately 60 kDa (N-terminal C. Freese et al. ADAM10 and neuregulin-1 processing FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1569 fragment) was detected in cell supernatants using the pan-NRG-1 antibody against the ectodomain, which recognizes a- as well as b-isoforms (Fig. 1C). This pro- tein reveals a slightly lower molecular weight com- pared to the results obtained by Ritch et al. [31] where secreted NRG-1 had a molecular mass of 70 kDa. Because at least two Asn residues and 11 Thr ⁄ Ser resi- dues were identified as potential sites for N- or O-gly- cosylation of NRG-1 [54], the deviation in the size of the soluble protein fragment may depend on different glycosylation patterns in the investigated cell lines. In mouse brain membranes, a panel of proteins in the approximate range of 160–70 kDa was observed (Fig. 1C), which corresponds to NRG-1 species described for mouse brain as well as human brain material [19]. Similar to cell supernatants, the soluble fraction of mouse brain contained a secreted form of NRG-1 of 55–60 kDa. Fig. 1. Isoforms of NRG-1 expressed in the human astroglioma cell line U373 and mouse brain. (A) In general, three major types of NRG-1 are generated, which all share an EGF-like domain; further variation is achieved through differences in the sequences of the C-terminal part of the EGF domain (a or b) isoforms, and the juxtamembrane region (e.g. a2orb1 isoforms) and other domains such as the type II specific Kringle or the type III specific cysteine-rich domain. (B) To identify mRNA species of NRG-1 present in the human astroglioma cell line U373, RT-PCR was performed. A sample lacking RNA was used as a no template control (NT) and a GAPDH sequence was amplified for the reaction control. (C) NRG-1 protein expression in U373 cells and mouse brain was analyzed using the antibody against the C-terminus or against the extracellular domain. Cell lysate or the membrane fraction from mouse brain was subjected to 4–12% NuPAGE and cell supernatants (medium) or soluble proteins from mouse brain were subjected to 8% SDS ⁄ PAGE. NRG-1 protein species (FL, full length; NTF, N-terminal fragment; CTF, C-terminal fragment) were visualized after transfer onto poly(vinylidene difluoride) membrane. ADAM10 and neuregulin-1 processing C. Freese et al. 1570 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS Table 1. Primer sequences used for NRG-1 isoform analysis. Specificity Primer Sequence (5¢-to3¢) Length of amplificate (bp) Juxtamembrane region NRG-jD_for NRG-TM_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC Approximately 200 (depending on isoform) Immunoglobulin domain (type I and II) NRG-IG_for NRG-TM_rev GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC 543 Glycosylation sites (type I) NRG-Glyc_for NRG-TM_rev CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC 339 Kringle (type II) NRG-Kringle_for NRG-Kringle_rev AGGAGGAGGAGTGGTGCTG GTCCCCAGCAGCAGCAGTA 239 Cysteine rich domain (type III) NRG-CRD_for NRG-CRD_rev GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC 219 a NRG-5¢_for NRG-a_rev TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG 668 b NRG-5¢_for NRG-Beta_rev TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC 677 GAPDH GAPDH_for GAPDH_rev GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT 450 Fig. 2. Proteolytical processing of APP and NRG-1 in U373 cells. U373 cells overexpressing human APP695 were incubated with inhibitors for b-secretase, c-secretase or metalloproteinases, or stimulated with phorbol 12-myristate 13-acetate. Proteolytic processing products of APP or NRG-1 were detected in culture supernatants after precipitation or in lysed cells with appropriate antibodies. (A) Cells were incubated with the tripeptidic inhibitor of the b-secretase (25 l M) and shedded APPs-b or NRG-1 was visualized by western blotting. (B) Full length pro- tein (FL) or C-terminal membrane tethered fragments (CTF) of either APP or NRG-1 were detected in cell lysates after an incubation period of 48 h with 2 l M DAPT. (C) Phorbol 12-myristate 13-acetate (PMA) (1 lM, 4 h) or GM6001 (10 lM, 26 h) were added to the cells to investi- gate the influence of metalloproteinases on secretion of NRG-1 ectodomain (NTF, N-terminal fragment) in U373 cells. APPs-a served as a control. All blots show samples from solvent-treated cells in lanes 1 and 3, whereas lanes 2 and 4 show samples from compound-treated cells. Blots are representative for at least three independently performed experiments per treatment. Quantifications display the mean ± SD; values from solvent-treated cells were set to 100% (Student’s t-test: ***P < 0.001; **P < 0.01; *P < 0.05). C. Freese et al. ADAM10 and neuregulin-1 processing FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1571 Proteolytical processing of NRG-1 in the human astroglioma cell line U373 The tripeptidic b-secretase inhibitor II led to an 80% reduction of soluble b-secretase cleaved APP (APPs-b) in cell culture supernatants and also diminished signifi- cantly the 60 kDa soluble NRG-1 in cell conditioned medium (N-terminal fragment; Fig. 2A). Furthermore, the c-secretase inhibitor N-[N-(3,5-difluorophenacetyl)- l-alanyl ]-S-phenylglycine t-butyl ester (DAPT), which induced accumulation of C-terminal fragments of APP in cell lysates (C-terminal fragment; Fig. 2B), increased the NRG-1 C-terminal fragment of approximately 50 kDa six-fold as compared to solvent-treated cells. These results demonstrate cleavage of NRG-1 in U373 cell line by both b- and c-secretase. Phorbol 12-myristate 13-acetate, a known inducer of shedding events, significantly elevated soluble APPs-a, as well as the soluble N-terminal fragment of NRG-1 in those cells, by 200% and 150% (Fig. 2C). For this reason, we analyzed metalloproteinase dependent shed- ding of NRG-1: APPs-a that acted as a control was reduced to 40% by the broad spectrum metalloprotein- ase inhibitor GM6001 as compared to solvent-treated cells, and NRG-1 cleavage also was reduced signifi- cantly, although to a lower extent (65% of control cells; Fig. 2C). Therefore, metalloproteinases appear to be involved in NRG-1 processing in the astrocytoma cell line U373, as previously described for other cell lines [28,55]. RNA interference (RNAi)-induced knockdown of ADAM10 has no influence on NRG-1 shedding Because GM6001, which was used for inhibitory stud- ies, is a broad spectrum inhibitor of MMPs as well as ADAMs, we chose the RNAi approach to analyze in particular the role of ADAM10 in NRG-1 cleavage. As a control for unspecific RNAi-induced effects, MMP2 knockdown was examined as well. RNAi treatment tar- geted against endogenous ADAM10 of the U373 cells resulted in a 60% reduction of mature ADAM10, whereas MMP2 targeted oligomers had no influence (Fig. 3A). The decrease of ADAM10 due to RNAi was accompanied by a 30% decrease in APPs-a shedding (Fig. 3B) serving as an internal control. Because APP is Immature Mature Fig. 3. Influence of siRNA mediated knock- down of ADAM10 on APP or NRG-1 processing in U373 cells. U373 cells were transfected with a set of RNA oligomers targeted to ADAM10 (AD). Mock-transfect- ed cells (C) or cells transfected with RNA oligomers against MMP2 (M) were used as controls. Forty-eight hours after transfection, cells were investigated with respect to ADAM10 and products of APP or NRG-1 proteolysis. (A) The mature and immature forms of ADAM10 in the cell lysates were detected by western blotting and the mature, catalytically active form of the enzyme was quantified. (B) APPs-a was enriched by trichloroacetic acid precipitation and visualized by the specific antibody 6E10. (C) Secreted (NTF, N-terminal frag- ment) and membrane bound NRG-1 species (CTF, C-terminal fragment) were detected in cell supernatants or lysates. All western blottings show two sets of independent samples. Quantifications are based on four independent experiments and show the mean ± SD; values from mock-transfected cells were set to 100% (one-way analysis of variance ⁄ Bonferroni post hoc test: ***P < 0.001; **P < 0.01). ADAM10 and neuregulin-1 processing C. Freese et al. 1572 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS not only a substrate for ADAM10, but also, for exam- ple, TACE, the absolute effect of ADAM10 knockdown was small but reached significance. By contrast, for NRG-1, we observed no alteration of soluble NRG-1 in cell culture supernatants, as well as for the membrane- bound protein species. Because of a potential compensa- tion of reduced NRG-1 cleavage by other secretases, we cannot exclude the possibility that ADAM10 might have an effect on proteolytic processing of NRG-1 in U373 cells but, if this is the case, ADAM10 at least is not a major sheddase of this protein (Fig. 3C). In vivo effect of ADAM10 on NRG-1 proteolysis Because ADAM10 was not implicated in the shedding of distinct NRG-1 isoforms of cultured human astro- glioma cells (a2 and b2; Fig. 1B), we analyzed NRG-1 processing in ADAM10 overexpressing mice to take into account all of the expressed isoforms. Two trans- genic mouse lines with different expression levels of ADAM10 (moderate, ADAM10mo; high, ADAM10hi) and a mouse line transgenic for a dominant negative ADAM10 mutant (ADAM10dn) were included in this investigation. All mouse lines have been examined in detail elsewhere with respect to APP processing, learn- ing and behaviour [40,41,56]. The expression of the proteinase itself is illustrated in Fig. 4A (lower part). In soluble protein fractions of brains derived from the three transgenic lines, the amount of the N-terminal fragment of NRG-1 (approximately 60 kDa; Fig. 4) was not changed compared to the wild-type. Addition- ally, neither full length NRG-1, nor C-terminal frag- ments in the brain membrane fraction were influenced by an altered ADAM10 amount or activity (Fig. 4). We therefore conclude that, in vivo, the proteolytic processing of NRG-1 does not depend on the a-secre- tase ADAM10. For further confirmation of these findings, we exam- ined the myelination of peripheral nerves in ADAM10 transgenic mice and mice overexpressing dominant negative ADAM10. Because myelination strongly depends on NRG-1-ErbB signalling of Schwann cells and neurones [57], any relevant change of this pathway induced by altered ADAM10 activity should be obser- vable as a physiological consequence. Again, the ADAM10 transgenes remained without effect in all investigated mouse lines (Fig. 5A). G-ratios of ADAM10mo as well as of ADAM10dn mice at postnatal day 17 were identical to nontransgenic litter- mates. Furthermore, Akt-phosphorylation, which also Fig. 4. Processing products of NRG-1 in ADAM10 transgenic mice. Soluble and membrane tethered fractions of NRG-1 from brains of ADAM10mo, ADAM10hi and ADAM10dn mice were detected by western blotting with antibodies against the N- (NT) or the C-terminus (CT) of the protein. Nontransgenic littermates (Wt, wild-type) were used as controls. Each western blot for NRG-1 shows samples from two indi- viduals: lanes 1 and 3 are from wild-type animals and lanes 2 and 4 are from transgenic mice. For ADAM10 (detection by HA-antibody), one exemplary blot from the brain membrane fraction of four individuals is shown. The proform of the proteinase is indicated by a black arrow head and the catalytically active form is indicated by a grey arrow head. (B) Protein bands with respect to shedded (N-terminal fragment; 60 kDa) or one exemplary C-terminal fragment (50 kDa) of NRG-1 were quantified and values from wild-type mice were set to 100% (mean ± SEM; n = 6 for each mouse line, P > 0.05). C. Freese et al. ADAM10 and neuregulin-1 processing FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1573 Fig. 5. ADAM10 transgenic mice display no disturbance in peripheral myelination. (A) Sciatic nerves of ADAM10mo, ADAM10dn and wild- type (Wt) mice (postnatal day 17) were analyzed for myelin sheath thickness by electron microscopy. Two exemplary microscopic images are shown for each mouse line. G-ratios were evaluated taking into account at least 350 individual axons per group (n = 3 animals for each group). (B) Myelination was analyzed in adult, aged ADAM10hi mice (15–17 months) in analogy to (A). Two electron microscopy images at two different magnifications (see scale bars) of transgenic mice and age-matched control mice are shown. Tomacula-like structures are indicated by black arrows. ADAM10 and neuregulin-1 processing C. Freese et al. 1574 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS is partly controlled by NRG-1 signaling [31,58,59], was unaffected in both mouse lines (Fig. 6). In adult mice with a high expression level of ADAM10 (ADAM10hi), G-ratios were also unaltered (Fig. 5B), but tomacula-like structures (local myelin thickenings [60]) were observed. Additionally, in the mouse line with higher ADAM10 expression (ADAM10hi), Akt- phosphorylation was significantly reduced to 40% compared to wild-type mice. This probably reflects effects that do not depend on NRG-1 cleavage. Discussion The data obtained in the present study for the human astroglioma cell line U373 clearly reveal BACE-1 and c-secretase dependent shedding of the endogenous ErbB receptor ligand, which we identified predomi- nantly as type a2-NRG-1 and, to a lesser extent, as the b2 isoform. Additionally, GM6001, a broad spec- trum metalloproteinase inhibitor, was able to reduce NRG-1 shedding but a specific knockdown of ADAM10 by RNAi remained without any effect within the cellular system. Therefore, the present study demonstrates that ADAM10 is not a major sheddase of neuregulin-1 and enhancement of ADAM10 will probably have no side effects due to NRG-1 cleavage. Because catalytically active ADAM10 is found on the plasma membrane [38] and neuregulin-1b1 cleav- age, for example, is restricted to the Golgi apparatus [28], it is plausible that distinct localization of ADAM10 and NRG-1 might inhibit a functional sub- strate–proteinase interaction. Furthermore, NRG-1 is mainly found in cholesterol rich lipid rafts [61,62], favouring its role as a BACE-1 substrate, whereas ADAM10 and its catalytic activity (at least for APP) were shown to be localized in cholesterol-poor nonraft regions of the membrane [39]. Nevertheless, a possible in vivo relevance of ADAM10 to NRG-1 shedding required investigation due to the fact that NRG-1 pro- teolysis also depends on, for example, electric stimula- tion of cells [8], which might be accompanied by translocation within the cell. Furthermore, the animal model offers a more complex representation because of the wide variety of cells that express NRG-1 and which might interact. Reconstitution experiments with transfection of ADAM10 in ADAM17) ⁄ ) embryonic mouse fibro- blasts [55] suggested only a minor influence of ADAM10 on neuregulin-1 shedding, but any positive proof in the living animal was still missing. Therefore, we investigated neuregulin-1 processing in mice with postnatal expression of ADAM10 or its dominant neg- ative variant. The Thy.1-promoter driven expression of both ADAM10-constructs [40] occurs at postnatal day 1 (data not shown). Thy.1-based expression in general is predominantly found in postmitotic neuro- nes of the perinatal period, but also occurs in dorsal root ganglia and in spinal cord [63]. Hence, the animal model is sufficient to study early ontogenetic phenom- ena after birth without disturbances due to impeded embryonic development in the central or peripheral nervous systems. In a recent study, the age-dependency of NRG-1 cleavage by BACE-1 was demonstrated [64]. Although the accumulation of full length neuregulin-1 in BACE) ⁄ ) mice aged 15 days confirmed previous data [29,34], mice at postnatal day 30 or even older (2 years) showed no abnormalities with respect to neu- regulin-1 processing. In the case of ADAM10, investi- gations of adult mice moderately overexpressing Fig. 6. Akt-phosphorylation in ADAM10 transgenic mice. (A) Total- Akt and phospho-Akt were detected by western blotting in soluble fractions of brains from ADAM10mo, ADAM10hi and ADAM10dn mice. Nontransgenic littermates (Wt, wild-type) were used as con- trols. (B) Phospho-Akt was normalized by total-Akt and quotients from wild-type mice were set to 100%. Values represent the mean ± SEM (n = 4 for each mouse line; one-way analysis of variance ⁄ Bonferroni post hoc test: **P < 0.01). C. Freese et al. ADAM10 and neuregulin-1 processing FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1575 ADAM10 or its dominant negative variant resulted in totally unchanged amounts of NRG-1 processing products. Therefore, the influence of ADAM10 on NRG-1 was additionally analyzed in young mice (postnatal day 17) by the status of peripheral nerve ensheathment. In the second postnatal week, myelination is almost finished in mice (central nervous system [65]; peripheral nervous system [66]); therefore, alterations should be apparent. However, neither moderate ADAM10 overexpressing mice, nor mice with a restriction of enzyme activity by dominant negative ADAM10, revealed differences in axon myelination parameters compared to wild-type littermates at postnatal day 17. Surprisingly, adult mice with high levels of ADAM10 overexpression showed myelin infoldings (tomacula-like structures). This observation has not been made in the context of reduced or enhanced NRG-1 signalling in mice [67]. We therefore suggest that mechanisms beside NRG-1 signal transduction might be responsible for the neuropathological pheno- type. It will be interesting to analyze these observa- tions in future studies. Additionally, Akt phosphorylation, a consequence of NRG-1-ErbB signalling [31,59], was unaltered by moderate overexpression or by inhibiting ADAM10 activity by its negative mutant form. However, mice with high overexpression of ADAM10 showed a strong decrease of phosphorylated Akt compared to non- transgenic mice. This observation may relate to recent findings demonstrating that a high level of ADAM10 overexpression in the mouse increases susceptibility to kainate-induced seizures and neuronal damage [56], whereas the neuroprotective properties of ADAM10 were only evident in mice with APP overexpression. In conclusion, ADAM10 was excluded both in cell culture and in the animal model as a major candidate secretase for neuregulin-1 shedding. We cannot rule out that other secretases, such as TACE or ADAM19, which were identified formerly as NRG-1 sheddases [28,30,55], compensate for the lack of ADAM10 in RNAi-treated cells or animals with overexpression of the dominant negative mutant. In breast cancer cells, ADAM10 was described to mediate the shedding of the receptor ErbB2 [68]; therefore, an influence on NRG-1-ErbB signalling could in principal have also occurred by ErbB2 cleavage in our transgenic mice. However, because we did not observe an influence on myelination in ADAM10 transgenic mice, this observa- tion might be restricted to tumour cells. We also cannot exclude that, in non-neuronal tis- sue, embryonic development or pathological stages ADAM10 itself, or cleavage products of its other sub- strates, might be involved in NRG-1-ErbB cross-talk. In summary, however, we present evidence demonstrat- ing that, in the healthy early postnatal and adult mouse, moderate alterations in the amount of ADAM10 do not interfere with neuregulin-1 signalling. Accordingly, ADAM10 will have no impact on down- stream physiological functions such as nerve remyelina- tion or the schizophrenia-resembling psychiatric changes as observed for BACE-1 knockout mice [34,69]. The results obtained in the present study there- fore suggest that a moderate upregulation of ADAM10 expression and its a-secretase activity with a preventive or therapeutical intention is not impaired by side effects resulting from the NRG-1-ErbB signalling network. Experimental procedures Antibodies, inhibitors and RNAi oligomers The primary antibodies used were: 6E10 for the detection of APPs-a (Senetek, St Louis, MO, USA; dilution 1 : 1000), anti-neuregulin-1 (H-210; dilution 1 : 200) for the detection of secreted NRG-1 fragments, anti-neuregulin- 1a ⁄ b1 ⁄ 2 (C-20; dilution 1 : 500) (both Santa Cruz Biotech- nology, Santa Cruz, CA, USA) for the detection of membrane bound NRG-1, anti-ADAM10 (Chemicon, Temecula, CA, USA; dilution 1 : 1000) for the detection of the proteinase in cells and 6687 (C. Haass, LMU Munich, Germany) for the detection of full length APP and C-termi- nal protein fragments. Anti-P-Akt and anti-total Akt were purchased from Cell Signaling [PhosphoPlus Akt (Ser473) Antibody Kit; Cell Signaling, Danvers, MA, USA]. Overex- pressed ADAM10 in mouse brain membranes was visual- ized by HA-antibody Y-11 (Santa-Cruz Biotechnology). The secondary antibodies were coupled to alkaline phos- phatase (Tropix, Bedford, MA, USA; dilution 1 : 10000) or horseradish peroxidase (Pierce, Rockford, IL, USA; dilution 1 : 3000) and were used in combination with their substrates CDP-Star (Tropix) or SuperSignalECL (Pierce). The b-secretase-inhibitor II (Calbiochem, Bad Soden, Germany) was applied at a concentration of 25 lm and the c-secretase inhibitor DAPT (B. Schmitt, Clemens Scho ¨ pf- Institute of Organic Chemistry and Biochemistry, Tech- nische Universita ¨ t Darmstadt, Germany) was applied at a concentration of 2 lm . GM6001 (Calbiochem, San Diego, CA, USA) was used at a final concentration of 10 lm and phorbol 12-myristate 13-acetate (Sigma, Deisenhofen, Ger- many) was used at a concentration of 1 lm. All substances were dissolved in dimethylsulfoxide as stock solutions. For the RNAi experiments, the Stealth RNAis ADAM10 HSS165, HSS166, HSS167 and MMP2 HSS106612, HSS106613, HSS106614 (Invitrogen, Karlsruhe, Germany) were used. Transfections were performed with Opti-MEM and Lipofectamine2000 (Invitrogen). ADAM10 and neuregulin-1 processing C. Freese et al. 1576 FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS RNA preparation and RT-PCR The RNA of U373 cells was isolated by using confluent 6 cm culture plates and the RNA isolation kit with on-column DNA digestion as recommended in the manufacturer’s pro- tocol (Macherey-Nagel, Du ¨ ren, Germany). Four hundred nanograms of RNA were reverse transcribed in a 20 lL reac- tion volume by the reverse-it-RT-PCR-kit from ABgene (Hamburg, Germany) with intron-spanning specific primers (0.2 lm each). Amplificates were analyzed on 1% agarose gels and GAPDH amplification served as a control for the RT-PCR reaction and PCR conditions. Primer sequences and the amplificate length are provided in Table 1. The amplificates from RT-PCR with primers NRG- jD_for and NRG-TM_rev were ligated into pUC19 (Fer- mentas, St Leon-Rot, Germany) and plasmid DNA from eight positive clones (identified by blue–white selection) was sequence analyzed with M13 universal primer. Preparation of mouse brain samples The generation of transgenic mice has been described previously [40]. Seven- to 10-week-old mice were sacrificed, the brains were dissected and stored on dry ice. Ice-cold Tris buffer (20 m m Tris ⁄ HCl, pH 8.5) containing proteinase inhibitors (Inhibitor Complete Mini; Roche Diagnostics Corp., Mannheim, Germany) was added and tissue was homogenized in a tissue lyser (Eppendorf, Hamburg, Ger- many) with a frequency of 20 Hz for 2 min. The superna- tants resulting from centrifugation at 13 500 g for 1.75 h were used for the detection and quantification of soluble NRG-1. NRG-1 membrane bound full length protein and membrane bound NRG-1 fragments, as well as the protein- ase ADAM10 itself, were detected in the membrane frac- tions prepared from centrifugation pellets. For total-Akt and phospho-Akt detection, brain hemi- spheres were homogenized in lysis buffer supplemented with additional phosphatase inhibitors (2.5 mm Na-pyrophos- phate, 1 mm b-glycerophosphate and 1 mm Na 3 VO 4 ) and soluble proteins were isolated from membrane fractions by centrifugation at 20 800 g for 20 min. Cell culture, treatment with inhibitors and RNAi silencing U373 cells overexpressing human wild-type APP were main- tained in MEM (Sigma, Taufkirchen, Germany) supple- mented with 10% fetal bovine serum, 1% sodium pyruvate and 1% glutamine. To inhibit b-secretase or metalloproteinases, cells were pretreated with the appropriate inhibitor ( b-secretase-inhibi- tor II or GM6001) for 22 h. Then, the serum containing culture medium was removed and medium without serum supplemented with fatty acid free BSA (1 mg ÆmL )1 ) and fresh inhibitor was added for an additional 4 h. Phorbol 12-myristate 13-acetate-induced shedding was performed for 4 h in serum free BSA supplemented medium. For inhi- bition of c-secretase, cells were treated with DAPT for 48 h in culture medium. For RNAi experiments, cells were transfected with 750 pmol of RNAi oligomers (250 pmol each) in six-well plates. After 5 h of transfection, the medium was replaced by culture medium. After 44 h, cells were covered with serum-free medium and incubated for 4 h for collection of secreted proteins and cell lysates. Western blotting Proteins of cell culture supernatants were precipitated with trichloroacetic acid and normalized by the protein content of the cell lysates. Adequate amounts of soluble or mem- brane tethered proteins were separated on 8% SDS-gels or 4–12% Bis–Tris NuPAGE gels (Invitrogen) and blotted on a poly(vinylidene difluoride) membrane or nitrocellulose (total-Akt and phospho-Akt). Proteins were then detected with the appropriate primary antibodies. Chemiluminescent signals from alkaline phosphatase or horseradish peroxidase coupled secondary antibodies were visualized with a charge-coupled device camera and the software versa doc (Bio-Rad, Munich, Germany) and were quantified with aida 3.5 (Raytest, Straubenhardt, Germany). Electron microscopy and G-ratio determination Seventeen-day-old or adult transgenic mice (15–17 months old) and nontransgenic littermates were perfused with NaCl ⁄ P i containing 60 lgÆmL )1 heparin followed by 2.5% glutaraldehyde ⁄ 4% parafomaldehyde in 0.1 m phosphate buffer. Afterwards, sciatic nerves were removed, postfixed and contrasted with osmium tetroxide and processed for electron microscopy [70]. biovision software (Soft Imaging System GmbH, Mu ¨ nster, Germany) was used for determi- nation of the G-ratio by measuring the inner and outer myelinated fibres. All animal procedures were performed according to the German guidelines for the care and the use of laboratory animals and in accordance with the European Communities Council Directive of 24 November 1986 (86/609/EEC). Acknowledgements We thank C. Griffel (MDC, Berlin) for excellent tech- nical support in the analysis of sciatic nerve myelina- tion; A. Schro ¨ der (ZVTE, Mainz) for coordination of animal husbandry and M. Willem (LMU, Munich) for fruitful discussion. This work was supported by grants from the DFG priority program 1040 (to F.F.) C. Freese et al. ADAM10 and neuregulin-1 processing FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors Journal compilation ª 2009 FEBS 1577 [...]... GABAergic interneurons of the hippocampus J Neurosci 21, 5660–5669 12 Yang X, Kuo Y, Devay P, Yu C & Role L (1998) A cysteine-rich isoform of neuregulin controls the level of expression of neuronal nicotinic receptor channels during synaptogenesis Neuron 20, 255–270 13 Huang YZ, Won S, Ali DW, Wang Q, Tanowitz M, Du QS, Pelkey KA, Yang DJ, Xiong WC, Salter MW et al (2000) Regulation of neuregulin signaling... (2004) Neuregulin-1beta induces neurite extension and arborization in cultured hippocampal neurons Mol Cell Neurosci 27, 379–393 22 Kwon OB, Longart M, Vullhorst D, Hoffman DA & Buonanno A (2005) Neuregulin-1 reverses long-term potentiation at CA1 hippocampal synapses J Neurosci 25, 9378–9383 23 Stefansson H, Sigurdsson E, Steinthorsdottir V, Bjornsdottir S, Sigmundsson T, Ghosh S, Brynjolfsson J, Gunnarsdottir... Yanagihara D (1995) Studies on the structure and function of glycosylated and nonglycosylated neu differentiation factors Similarities and differences of the alpha and beta isoforms J Biol Chem 270, 4784–4791 Horiuchi K, Zhou HM, Kelly K, Manova K & Blobel CP (2005) Evaluation of the contributions of ADAMs 9, 12, 15, 17, and 19 to heart development and ectodomain shedding of neuregulins beta 1 and beta... (2006) Control of peripheral nerve myelination by the beta-secretase BACE1 Science 314, 664– 666 30 Montero JC, Yuste L, az-Rodriguez E, Esparis-Ogando A & Pandiella A (2000) Differential shedding of transmembrane neuregulin isoforms by the tumor necrosis factor-alpha-converting enzyme Mol Cell Neurosci 16, 631–648 31 Ritch PS, Carroll SL & Sontheimer H (2005) Neuregulin-1 enhances survival of human... (2008) Effects of neuronspecific ADAM10 modulation in an in vivo model of acute excytotoxic stress Neuroscience 152, 459–468 Nave KA & Salzer JL (2006) Axonal regulation of myelination by neuregulin 1 Curr Opin Neurobiol 16, 492–500 Hellyer NJ, Kim MS & Koland JG (2001) Heregulindependent activation of phosphoinositide 3-kinase and Akt via the ErbB2 ⁄ ErbB3 co-receptor J Biol Chem 276, 42153–42161 Monje... by the Nrg-1 intracellular domain J Cell Biol 161, 1133–1141 33 Zhang Z, Prentiss L, Heitzman D, Stahl RC, DiPino Jr F & Carey DJ (2006) Neuregulin isoforms in dorsal root ganglion neurons: effects of the cytoplasmic domain on localization and membrane shedding of Nrg-1 type I J Neurosci Res 84, 1–12 34 Hu X, Hicks CW, He W, Wong P, Macklin WB, Trapp BD & Yan R (2006) Bace1 modulates myelination in the. .. beta-secretase 1 inhibition leads to brain Abeta lowering and increased alpha-secretase processing of amyloid precursor protein without effect on neuregulin-1 J Pharmacol Exp Ther 324, 957–969 Foran DR & Peterson AC (1992) Myelin acquisition in the central nervous system of the mouse revealed by an MBP-Lac Z transgene J Neurosci 12, 4890–4897 Low PA (1976) Hereditary hypertrophic neuropathy in the. .. ligands: from an oncogene to neural factors Bioessays 15, 815–824 Lacroix-Fralish ML, Tawfik VL, Nutile-McMenemy N, Harris BT & Deleo JA (2006) Differential regulation of neuregulin 1 expression by progesterone in astrocytes and neurons Neuron Glia Biol 2, 227–234 Tokita Y, Keino H, Matsui F, Aono S, Ishiguro H, Higashiyama S & Oohira A (2001) Regulation of neuregulin expression in the injured rat brain.. .ADAM10 and neuregulin-1 processing C Freese et al and from the NGFN integrated consortium ‘Gene Identification and Functional analyses in Alzheimer’s disease’ funded by the Federal Ministry of Education and Research (to A.N.G.) References 1 Buonanno A & Fischbach GD (2001) Neuregulin and ErbB receptor signaling pathways in the nervous system Curr Opin Neurobiol 11, 287–296 2 Esper RM, Pankonin... 1257–1264 Thompson RJ, Roberts B, Alexander CL, Williams SK & Barnett SC (2000) Comparison of neuregulin-1 expression in olfactory ensheathing cells, Schwann cells and astrocytes J Neurosci Res 61, 172–185 Oberto M, Soncin I, Bovolin P, Voyron S, De BM, Dati C, Fasolo A & Perroteau I (2001) ErbB-4 and neuregulin expression in the adult mouse olfactory bulb FEBS Journal 276 (2009) 1568–1580 ª 2009 The Authors . of NRG-1 does not depend on the a-secre- tase ADAM10. For further confirmation of these findings, we exam- ined the myelination of peripheral nerves in ADAM10 transgenic. interact. Reconstitution experiments with transfection of ADAM10 in ADAM17) ⁄ ) embryonic mouse fibro- blasts [55] suggested only a minor influence of ADAM10 on neuregulin-1