the vapor pressure of a given liquid depends on
The Marketing Strategy of a multinational join stock company.doc
... adaptationAdapt promotion Communication adaptationDual adaptationProduct inventionTable 1.1: Five international product and promotion strategies.Product adaptation involves changing the ... later based on to research. The definition, the goals of marketing , the contents of marketing as well as implementation and control are main parts of chapter one. Gaining an insight into the theory ... trademark, and the package of product. Each of the products of a multinational join stock company has a separate trademark and color.Besides, a multinational join stock company has always tried...
- 25
- 623
- 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
... you change the DataColumn in the parent DataTable on which the ForeignKeyConstraint was created, then the same change is also made in any corresponding DataRow objects in the child DataTable. ... in the child DataTable. This is the default. None Indicates that no action takes place. SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the ... UpdateRule is set to None. ã The CommandText of the Command object in the UpdateCommand of the DataAdapter is the same as in the second case. The following code sets the UpdateRule of the...
- 6
- 428
- 0
Reliability analysis of a power system based on the multi state system theory
... 22.8ssRG=≥}Equation (1) indicates that when the capacity of the system is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh. Suppose the capacity of the first ... G is the capacity of the battery. 2150()2~ 6000,150GNTo analyze the reliability of the system by the traditional system reliability theory, we must gain the reliability of the battery ... reliability theory defines the power system and the batteries are binary, but they are all multi-state actually. The performance of the batteries can degrade, which results in performance degradation...
- 4
- 407
- 0
Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt
... draconian measures such as the confiscation of particular issues of publications, including newspapers or restrictions on the publication of specific articles.73 Arguably, the practice of banning ... Document of the Moscow Meeting of the Conference on the Human Dimension of the CSCE and in breach of Article 19 of the International Covenant on Civil and Political Rights and Article 10 of the ... the other participating States”, “make it their aim to facilitate the freer and wider dissemination of information of all kinds” and “encourage co-operation in the field of information and the...
- 238
- 2,697
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* ... calibration standards provided by the manu-facturer. Data processing was performed using the deconvo-lution module of the data analysis software to detect the multiple charge states and obtain ... maintaining the geometry of the active site. The availability of crystal structures of TIMs from 21 sources and the large database of TIMsequences from various sources facilitate an analysis of mutational...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
... chloroplast spinach GAPDH [35] w ere examined t oAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcusAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcusAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcus119119119119119120119121118119159159159159157158157160158159199199199199197198197200198199VI ... oAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcusAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcusAthalianaBPativumBSoleraceaBNtabacumB A. thalianaAPsativumASoleraceaAChlamySynechocystisSynechococcus119119119119119120119121118119159159159159157158157160158159199199199199197198197200198199VI ... globalfitting assuming a 1 : 1 interaction withBIAEVALUATION3.1.Table 5. Dissociation c onstants and quantification of the destabilizingeffect of the mutations on the interaction between m utant...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... tunedmodels on other three data sets.Data: The sense inventory is WN3.0 for the fourWSD data sets. WMF and LDA are built on the cor-pus of sense definitions of two dictionaries: WN andWiktionary [Wik].2We ... example, the jcn similarity measure (Jiang and Conrath, 1997)computes the sense pair similarity score based on the information content of three senses: the two sensesand their least common ... link the senses acrossdictionaries, hence Wik is only used as augmenteddata for WMF to better learn the semantics of words.All data is tokenized, POS tagged (Toutanova et al.,2003) and lemmatized,...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... mutagenesis reactions together with oligonucleo-tides ECF-Q69G d(5Â-AACAACGCAGCTGGGCTCTGGAACCAT), ECF -A1 41Q d(5Â-TCAACCTCTAACCAGGCTACTCCGCTG) ECM-G77Q d(5Â-AACAACGCTGGCCAGCACGCTAACCAC) and ... simultaneously afterinoculation of media with cultures grown to exponentialphase in the absence of paraquat and IPTG (Materialsand methods [24]). The final concentration of paraquatand IPTG ... Vb(equal to 1 unit of SODactivity under standard conditions). After incubation of aliquots at the required temperature or after addition of sodium azide at the required concentration, Vswas meas-ured...
- 12
- 740
- 0
Tài liệu Báo cáo Y học: Targeting of malate synthase 1 to the peroxisomes of Saccharomyces cerevisiae cells depends on growth on oleic acid medium pptx
... extra-peroxisomal Aco1p.As mentioned previously, malate synthase catalyses the formation of malate from glyoxylate and acetyl-CoA, the source of the latter being either peroxisomal when breakingdown ... (Fig. 4A) .To examine whether a cytosolic malate synthase was asefđcient as a peroxisomal one for m aintaining a functionalglyoxylate cycle on oleic acid, liquid growth assays wereconducted. The ... compart-mentalization of malate synthase was not strictly essential, itwas advantageous for cells to grow on oleic acid (Fig. 4C). The greater sensitivity of liquid growth assays on oleic acidcompared...
- 8
- 444
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... 5–8). The pK a of Asp140 is much lower than that of Asp142 andGlu144 in all situations where all three residues are presentand the one proton shared by Asp140 and Asp142 appearsto remain on Asp142 ... with partialcharges being formed, and covalent bonds being formedand broken). Thus, the calculated effect of rotation of Asp142 on the pK a of Glu144 only gives an indication of what may happen ... depending on the position of Asp142 and the calculation used.Interestingly, the calculations also suggest that the magni-tude of this effect is in part due to the presence of the negatively charged Asp215...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
... of data. The first is a selection of data from CoNLL-2004 and contains 8936 sentences. The seconddataset is part of the Lancaster Treebank corpusand contains 1473 sentences. Each sentence con-tains ... Grammar ParsingCreation of a parse tree involves describing lan-guage grammar in a tree representation, whereeach path of the tree represents a grammar rule.Consider a sentence from the Lancaster ... structure of an HHMM The models discussed here are evaluatedby applying them to natural language tasksbased on CoNLL-20041and a sub-corpus of the Lancaster Treebank2.Keywords: information extraction,...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
... and barley a- amylases are thus also presented.MATERIALS AND METHODSSUMAsoftware: subsite mapping of amylasesThis software calculates the apparent binding energies on the basis of the measured ... product analysis. The Suganuma method isbased on the calculation of the kinetic parameter (k0/Km)and the BCF data at sufficiently low substrate concentra-tion, where secondary attacks on the ... Mapping of a- Amylases) is freely availablefor research and educational purposes via the Internet(E-mail: gyemant@tigris.klte.hu). The advantages of this program are demonstratedthrough a- amylases...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
... Murakawa, M., Takahashi, S., Tsubuki, S.,Kawashima, S., Sakamaki, K. & Yonehara, S. (1998) Purification,molecular cloning, and characterization of TRP32, a novelthioredoxin-related mammalian ... hTRXL, the functionalidentification of the gene product and the structuredetermination of its N-terminal catalytic domain.MATERIALS AND METHODSDDRT-PCR and full-length cDNA isolationTotal RNA ... negative) than the latter. As the C-terminal regionis rich in acidic amino acids, if it does have some interactionwith the N-terminal domain, the mechanism of regulating the catalytic activity may be...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
... the reaction mechanism of a bacterial ATP-citrate lyaseTadayoshi Kanao, Toshiaki Fukui, Haruyuki Atomi and Tadayuki ImanakaDepartment of Synthetic Chemistry and Biological Chemistry, Graduate ... case of Ec-SCS [21], although the phos-phorylation of the a- subunit alone (80% of the subunit after24 h) was much slower than AclA alone (90 min). A majorcontribution of AclB, as well as the ... products,AclA (a subunit) and AclB (b subunit). By comparing the primary structures of AclA and AclB with that of the mammalian enzyme, we found that AclA and AclBCorrespondence to T. Imanaka, Department...
- 8
- 551
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25