Anatomy and Function of a Gene: Dissection Through Mutation
Anatomy and Function of a Gene: Dissection Through Mutation
... – bacteria – Used at replication forks that stalled because of unrepaired DNA damage – "Sloppy" DNA polymerase used instead of normal polymerase – Adds random nucleotides opposite damaged bases ... DNThai General observations of mutation rates • Mutations affecting phenotype occur very rarely • Different genes mutate at different rates • Rate of forward mutation is almost always higher than ... 7.1 Mutations: Primary tools of genetic analysis • Mutations are heritable changes in DNA base sequences • Forward mutation – changes wild-type allele to a different allele – e.g A+ a or b+...
- 56
- 220
- 0
Anatomy and Function of a Gene: Dissection Through Mutation (cont)
... mutagenic chemicals Cells have evolved a number of enzyme systems that repair DNA and thus minimize mutations Mutations are the raw material of evolution Although some mutations may confer a selective ... of an autosomal gene VNU-University of Science - DNThai Alkaptonuria: An inborn error of metabolism The biochemical pathway in humans that degrades phenylalanine and tyrosine via homogentisic acid ... acid (HA) In alkaptonuria patients, the enzyme HA hydroxylase is not functional so it does not catalyze the conversion of HA to maleylacetoacetic acid As a result, HA, which oxidizes to a black...
- 24
- 199
- 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc
... Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, ... Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria 2 2 2 2 ... Chromohalobacter salexigens DSM3034 Acinetobacter sp (strain ADP1) Pseudomonas fluorescens Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria...
- 13
- 390
- 0
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot
... this gene was designated naoA (nitroalkane-oxidizing enzyme gene) Expression of naoA in E coli To study the function of the naoA gene, it is necessary to obtain an adequate amount of NaoA protein ... recombinant NaoA after Sephadex G75 chromatography; lane 5, purified recombinant NaoA after DEAE-Sepharose Fast Flow chromatography; lane 6, standard molecular mass markers (phosphorylase b, 97 kDa; ... sequence of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces; partial purification of the related enzyme from Streptomyces has been reported [16] The deduced aminoacid sequence of NaoA from...
- 6
- 255
- 0
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg ... TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG AGGATGACGA TGAAGCGCCA 480 Fig Sequence of recombinant plasmid DNA containing TI gene fragment Expression...
- 9
- 497
- 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... domain of each subunit contributes to the formation of the hydrophilic pore ACh binding protein has structural and functional homology to the extracellular ligand binding domain of the nAChR, and ... development of selective drugs is the identification and pharmacological characterization of the various receptor subtypes, and the determination of their precise subunit composition and physiological function( s) ... targets the a/d interface of the mammalian muscle nAChR and is the only ligand selective for the Torpedo a/d interface [33] (Fig 2A) However, information on the activity of EI at neuronal subtypes...
- 15
- 757
- 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt
... C An et al Manduca sexta Spatzle ¨ Introduction A prominent feature of the innate immune systems of insects is the activation of serine proteinase cascade pathways in hemolymph, which function ... gene In the clade including Spatzle- 1, the branch lengths are noticeably longer and ¨ the bootstrap values are lower than in the other clades containing Spatzle- 2 to Spatzle- 6, indicating a lower ... cleavage of proSpatzle- 1A after ¨ incubation with the M sexta clip-domain serine proteinases HP6 or proPO-activating proteinase-1 (data A not shown) In the absence of b-mercaptoethanol, Spatzle- C108...
- 15
- 540
- 0
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax ... proteins A- 6-D45918: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acyl -D-amino acid amidohydrolase; A- 6-D45919: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acyl-D-Asparate amidohydrolase; A- 6-D50061:...
- 11
- 656
- 0
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx
... partial active enzyme intermediate, and kfast and kslow are A nity labelling of maize GST I (Eur J Biochem 271) 3505 the rate constants for the slow and fast phase of the reaction Analysis was ... B-factors of Met121 at ˚ ˚ the A and B chains are 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms are 38.14 A ively It is therefore reasonable to propose that conformational ... indicates the absence of any structural perturbation caused by the mutation Aminoacid analysis of the SDTG-modified Phe51Ala mutant and determination of its total amino and carboxy content suggests that...
- 9
- 556
- 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx
... alkaline phosphatase Materials and methods Bacterial identification and culture conditions DNA manipulation and sequence analysis Plasmid DNA preparation, purification of DNA from agarose gel, and restriction ... TACAAT TATAAT TAAAAT TACTAT TATAAT TAATTT TATAAT TATAAT + – – + – + + CIRCE – This work [10] [9] [61] [62] [63] [38] [64] [37] Fig SDS/PAGE analysis of expression and purification of the recombinant ... this paper, we report the gene cloning and characterization of a thermostable Lon protease from Brevibacillus thermoruber WR-249 We show that the recombinant Br thermoruber Lon protease (Bt -Lon) ...
- 11
- 505
- 0
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx
... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... retrieved from the NCBI database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A2 (Q42578) and ... Analysis and expression of the class III peroxidase large gene family in Arabidopsis thaliana Gene 288, 129–138 Tanaka S, Ikeda K, Ono M & Miyasaka H (2002) Isolation of several anti-stress genes...
- 14
- 347
- 0
Báo cáo khoa học: Structure and function of human a-lactalbumin made lethal to tumor cells (HAMLET)-type complexes pptx
... treatment of human or bovine a-lactalbumin at temperatures of 50, 60 or even 80 °C have resulted in the generation of cytotoxic HAMLET or bovine a-lactalbumin made lethal to tumor cells (BAMLET) complexes ... HAMLET Cytotoxicity of ELOA complexes Similar to HAMLET, the assembly of equine lysozyme and oleic acid into ELOA complexes led to cytotoxic activity ELOA effectively reduced the viability of mouse ... Bjerkvig R & Svanborg C (2004) Human a-lactalbumin made lethal to tumor cells (HAMLET) kills human glioblastoma cells in brain xenografts by an apoptosis-like mechanism and prolongs survival Cancer...
- 12
- 525
- 0
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx
... E.P., Martin-Eauclaire, M.F., Mansuelle, P & Sampieri, F (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian ... Sampieri, F & Granier, C (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the a- and b-sites of the mammalian sodium channel: sequence and circular dichroism ... obtained was displayed an ORF of 258 bp encoding a polypeptide of 85 amino acids and termed BmKIM The 5¢ and 3¢ UTRs of BmKIM cDNA are 17 bp and 76 bp, respectively A single AATAAA polyadenylation...
- 8
- 473
- 0
Báo cáo Y học: Molecular and biochemical characteristics of a gene encoding an alcohol acyl-transferase involved in the generation of aroma volatile esters during melon ripening pptx
... hypersensitivity-related proteins of Arabidopsis and tobacco; and (b) acyl transferases such as anthranilate N-hydroxy-cinnamoyl/benzoyl-transferase (NHCBT)-like protein of Arabidopsis and Dianthus caryophyllus, ... strawberry [9] and yeast AATs [33] CMAAT1 was capable of accepting branched alcohols such as 2- and 3-methylbutyl alcohol (also named amyl and isoamyl alcohols) The position effect of the methyl group ... CM-AAT2 and homologues, including: Arabidopsis anthranilate NHCBT, Nicotiana tabacum hsr201, Saccharomyces alcohol acetyl-transferases (ATF1 and ATF2), Catharanthus roseus Cr-DAT, Clarkia BEAT,...
- 8
- 509
- 0
Báo cáo hóa học: " Cloning and overexpression of a new chitosanase gene from Penicillium sp. D-" pot
... 5’-GGGCATCACAGACCTGTTAT-3’ 5’-AAYATGGAYATHGAYTGYGA-3’ 5’-RTCDCCCCADATNCCRTA-3’ 5-CCAGAGCACGTTGGCATCAA-3 5-ACCATAGTCGGACTTGACCT-3 5’-GGTCTGCAACAACAAGCTCATC-3’ 5’–GAGTCGATGCCGTCTTGATC-3’ 5’-CGCCATATGAAAACAGCTGCCATT-3 ... Acta 1205:183–188 Gupta V, Prasanna R, Natarajan C, Srivastava AK, Sharma J (2010) Identification, characterization, and regulation of a novel antifungal chitosanase gene (cho) in Anabaena spp Appl ... activity and stability of chitosanases Chitosanase activity was measured at the pH range of 2.5 to 8.0 for 30 before assayed by standard assay method The residual chitosanase activity was also measured...
- 24
- 389
- 0
Từ khóa: anatomy and function of the heart valvescloning expression function structure and immunoreactivities of a sphingomyelinase d from loxosceles adelaida a brazilian brown spider from karstic areasheart muscle the heart as a pump and function of the heart valvescloning sequencing and expression of a novel goose type lysozyme gene with chitinase ra chic activity from the moderately thermophilic bacterium ralstonia sp a 471description of imaging methods used to study brain anatomy and functiondevelopment sustained cognitive deficits and alterations in structure and function of the brain and the hpa aanatomy innervation and function of the orbicularis oculi muscleaudiovisual integration in nonhuman primates a window into the anatomy and physiology of cognitionan approach to elucidating the function of a novel gene called brefunction logic and context of a modulenatural mould and soil of a gardenname and function of each partthe life and death of a rogue apanatomy and physiology of the heart pdf free downloadanatomy and physiology of the cnschuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP