audiovisual integration in nonhuman primates a window into the anatomy and physiology of cognition
Tài liệu Báo cáo Y học: A Raman optical activity study of rheomorphism in caseins, synucleins and tau New insight into the structure and behaviour of natively unfolded proteins pot
... stones form in the mammary gland during lactation and contain a group of amyloid-staining peptides that start at position 81 of aS2-casein In another recent report, reduced j-casein was observed ... jcasein ROA bands are therefore assigned to PPII structure The positive ROA bands in b- and j-casein at » 1290± 1295 cm)1 may originate in other types of loops and turns A negative ROA band in ... recombinant human versions of synucleins, together with the A3 0P and A5 3T mutants of a- synuclein that cause familial cases of Parkinson's disease Unfortunately the quality of some of these synuclein...
- 9
- 667
- 0
báo cáo khoa học: " Worry as a window into the lives of people who use injection drugs: a factor analysis approach" pot
... for each variable and to determine if they are associated, we calculated their means and standard deviations These results are presented in Table with the individual variables placed according ... (CLEAN), police taking needles (TAKE) and missing your smash (SMASH), and contributes another 24% of the total variance The third factor includes the variables relating to worry about contracting ... worry about having a place to stay, being robbed (mean = 2.91), and contracting hepatitis C (mean = 2.89) Also shown in Table is a measure of inter-variable reliability known as Cronbach's alpha,...
- 6
- 333
- 0
a research into the role and the use of first language in general-english classes at hanoi university of industry = nghiên cứu về vai trò và việc sử dụng ngôn ngữ thứ nhất trong các lớp học tiếng anh cơ bản
... reason not to use L1 as a means of teaching or as a tool for checking and validating L2 learners understanding of word meaning But the researcher does want to emphasize, in line with the findings ... for the Monolingual Approach to teaching in the literature and advocates usually organize their support around claims: The learning of an L2 should model the learning of an L1 (through maximum ... vocabulary teaching Sửkmen (1997) states that vocabulary teaching was based on a top-down, naturalistic, and communicative approach which emphasized implicit and incidental learning of vocabulary The...
- 50
- 956
- 2
A research into the role and the use of first language in General-English classes at Hanoi University of Industry
... to the pedagogic methodology, especially in teaching English in general and in teaching vocabulary at universities in Vietnam as well as at Hanoi University of Industry in particular The reason ... However, there seems to be an increasing conviction that the first language (L1) has a necessary and facilitating role in the second and foreign language (L2) classroom Many English language professionals ... The study of Ringbom in 1987 clearly indicates that L1 clearly has a very important role to play in the deliberator learning vocabulary (Nation, 2001) Auerbach (1993) claims that the use of the...
- 9
- 554
- 2
the chamber a look into the novel and film
... governor's mansion -and he'll stand there in the glare of a hundred cameras and deny me clemency And the bastard will have tears in his eyes.' " (Grisham 122) Ruth Kramer and her family are the characters ... is Sam Cayhall's granddaughter; she has trouble getting rid of the painful memory that is her father Lee becomes an alcoholic to deal with her pain of being the daughter of Sam Cayhall Her pain ... Chamber, does not approve of Universal's film adaptation "As his asking price has soared, so has his involvement Grisham had approval of the script, director and cast during the making of A Time to Kill...
- 3
- 478
- 0
báo cáo khoa học: " New insight into the structures and formation of anthocyanic vacuolar inclusions in flower petals" potx
... Figure of in planta and in vitro isolated AVIs of the adaxial cells of the inner petal region of lisianthus flowers Micrographs Micrographs of in planta and in vitro isolated AVIs of the adaxial ... deposits and strands was also apparent for the AVIs isolated from the adaxial epidermis of lisianthus inner petal and placed in water (Fig 3C) All these examinations of AVIs, both in live cells and as ... surfaces of the AVIs in adaxial epidermal cells appeared as a collection of irregular colored deposits and strands that were tangled in the central space of the vacuole (Fig 3A) The pink area surrounding...
- 14
- 260
- 0
Báo cáo y học: "Qualitative and quantitative research into the development and feasibility of a video-tailored physical activity intervention" pptx
... Department of Health and Aged Care (DHAC): National Physical Activity Guidelines for Australians Commonwealth Department of Health and Ageing Canberra: Department of Health and Ageing; 1999 Vandelanotte ... anonymity of such program rather than having to interact with a ‘real’ person, and indicated that under such Vandelanotte and Mummery International Journal of Behavioral Nutrition and Physical Activity ... analyses and manuscript development; WKM was involved in conceptualization, data collection and analyses All authors read and approved the final manuscript Competing interests The authors declare that...
- 11
- 427
- 0
an investigation into the meaning and structure of a pictorial story - a systemic functional analysis = nghiên cứu cấu trúc và ngữ nghĩa của một truyện tranh phân tích theo quan điểm chức năng
... functional grammar with four strata and some features; three components of meaning in language: ideational, interpersonal, and textual and their realizations in the Transitivity, Mood, and Theme ... 2.4.2 Interpersonal Metafunction Clause is organized as an interactive event involving speaker/writer and audience In the act of speaking, speaker adopts a particular speech role and assigns to the ... (2) the interpersonal with which a clause is analyzed into Mood and Residue; and (3) the textual with which a clause is analyzed into Theme and Rheme In this chapter, the five main types of cohesion...
- 44
- 718
- 1
A research on the advantages and disadvantages of the application of task-based approach in teaching speaking to the fisrt-year non -English major students at H
... skill in language teaching 1.2.1 What is speaking skill? 1.2.2 The importance of speaking skill in language teaching programs .8 1.3 Factors affecting TBLT application in ... TWO: THE STUDY 12 2.1 The context of the study 12 2.1.1 English language teaching at HaUI 12 2.1.2 The teaching materials and assessment 13 2.1.3 Teachers and ... Teaching and learning facilities 14 2.2 The research methodology 14 2.2.1 Research questions .14 2.2.2 The participants 15 2.2.3 Data collection instruments...
- 4
- 951
- 6
A research on the advantages and disadvantages of the application of task-based approach in teaching speaking to the fisrt-year non-English major students at Ha
... skill, their attitudes to the application of a task-based approach in teaching and learning English speaking and their perception of advantages and disadvantages when using a task-based approach in ... and to exploit the advantages in implementing this approach Aims of the study The study is aimed at finding out the advantages and disadvantages of using a taskbased approach in teaching speaking ... mainly focuses on the advantages and disadvantages of using a taskbased approach as perceived by the teachers and students of HaUI in English speaking teaching and learning It involves the participation...
- 62
- 1,347
- 2
A STUDY ON THE DURABILITY AND PERFORMANCE OF PHOTOVOLTAIC MODULES IN THE TROPICS
... conditions can happen inside PV modules as the EVA encapsulant releases acetic acid as a result of photo/thermal degradation and oxygen/water can diffuse into the EVA layer So even for noble material ... Osterwald et al [19] studied the mechanism of potential-induced degradation and showed that leakage current and the total charge transferred were closely related to power degradation Czanderna and ... crosslinks with adjacent chains that increases the gel content Also, the stability of UV absorber content in EVA film formulation is another cause of photo-thermal degradation for the encapsulant...
- 119
- 655
- 0
A framework for the analysis and assessment of accountability arrangements in the public domain
... Accountants Act, the Accountability for Presidential Gifts Act, and the Arafat Accountability Act, to the Polluter Accountability Act, the Syria Accountability Act, and the United Nations Voting Accountability ... forms of accountability, including obligations to inform, interpellations, parliamentary debates and inquiries, that in the Netherlands have been laid down in the Constitution, the Parliamentary Inquiry ... public accountability, the purpose of accountability lies more in maintaining and strengthening the learning capacity of the public administration (Van den Berg 1999: 40; Aucoin & Heintzman 2000:52-54)...
- 37
- 535
- 0
Báo cáo Y học: Effect of the disease-causing mutations identified in human ribonuclease (RNase) H2 on the activities and stabilities of yeast RNase H2 and archaeal RNase HII pot
... 5¢-FAM-labeled 29 base DNA13-RNA4-DNA12 (5¢-AATA GAGAAAAAGaaaaAAGATGGCAAAG-3¢) and DNA15RNA1-DNA13 (5¢-AATAGAGAAAAAGAAaAAAGATG GCAAAG-3¢) with a 1.5 molar equivalent of the complementary DNA, ... 5¢-ATATGAA TTCTCTCTAAGGAGATATACTTATGACCGTTTCCAA CATTGGG-3¢ for RNH2B-F; 5¢-GGGGAAGCTTCTA GTGGTGGTGGTGGTGGTGCTTACGTTTAAAAAAT CCATC-3¢ for RNH2B-R; 5¢-ATATAAGCTTCTCTCAA GGAGATATACTTATGACCAAAGATGCCGTG-3¢ ... of Tk-RNase HII The sequences of DNA15RNA1-DNA13 of [rA]1, DNA13-RNA4-DNA12 of [rA]4, and RNA29 of [rA]29 around the cleavage sites are indicated along the gel The major cleavage sites of [rA]1...
- 14
- 482
- 0
beer tap into the art and science of brewing mar 2003
... and increasing imports of tea and coffee saw a change in domestic drinking habits— tea instead of ale for breakfast In the late 1700s, there was a decline in beer brewed at home, reflecting the ... are good and bad footballers, and good and bad vicars, indeed good and bad virtually anything, then there are certainly beers (rather too many of them) that are plainly deplorable Unquestionably, ... is a whopping 92 cents per gallon in Hawaii Other high rates are in Alabama, North Carolina, South Carolina, Florida, and Georgia, whereas rates are somewhat low in Colorado, Maryland, Missouri,...
- 247
- 490
- 0
a path with heart - a guide through the perils and promises of spiritual l- jack kornfield
... further training in monasteries of Thailand, India, and Sri Lanka and then studied with several renowned Tibetan lamas, Zen masters, and Hindu gurus In nineteen years of teaching I’ve had the ... that are now available in the West They have been initiated by lamas, done Sufi dancing in the mountains, sat a Zen retreat or two, and participated in shamanic rituals, and yet they ask: Why am ... mindfulness are: awareness of the body and senses, awareness of the heart and feelings, awareness of the mind and thoughts, and awareness of the principles that govern life (In Sanskrit these principles...
- 250
- 467
- 0
an inquiry into the nature and causes of the wealth of nations phần 1 doc
... great inlets, such as the Baltic and Adriatic seas in Europe, the Mediterranean and Euxine seas in both Europe and Asia, and the gulfs of Arabia, Persia, India, Bengal, and Siam, in Asia, to carry ... that of a nailer in the remote and inland parts of the Highlands of Scotland Such a workman at the rate of a thousand nails a day, and three hundred working days in the G.ed p32 The Wealth of ... inland parts of Africa, and all that part of Asia which lies any considerable way north of the Euxine and Caspian seas, the ancient Scythia, the modern Tartary and Siberia, seem in all ages of the...
- 76
- 677
- 1
an inquiry into the nature and causes of the wealth of nations phần 2 doc
... rises in the one and sinks in the other In a year of sudden and extraordinary plenty, there are funds in the hands of many of the employers of industry sufficient to maintain and employ a greater ... labour In the same islands they knit worsted stockings to the value of a guinea a pair and upwards The spinning of linen yarn is carried on in Scotland nearly in the same way as the knitting of stockings ... in the inland than in the foreign trade, and in some branches of foreign trade than in others; in the trade to North America, for example, than in that to Jamaica The ordinary rate of profit always...
- 75
- 618
- 0
an inquiry into the nature and causes of the wealth of nations phần 3 pdf
... maintain their inhabitants They are rich in the industry and skill of their artificers and manufacturers; in every sort of machinery which can facilitate and abridge labour; in shipping, and in all ... labour, and therefore more money, to bring first the materials, and afterwards the complete manufacture to market In China and Indostan the extent and variety of inland navigation save the greater ... circumstances Thus in every farm the offals of the barn and stables will maintain a certain number of poultry These, as they are fed with what would otherwise be lost, are a mere save-all; and as they...
- 75
- 458
- 0
an inquiry into the nature and causes of the wealth of nations phần 4 pot
... rent of his land Of the produce of a great manufactory, in the same manner, one part, and that always the largest, replaces the capital of the undertaker of the work; the other pays his profit, and ... consequently the exchangeable value of the annual produce of the land and labour of the country, the real wealth and revenue of all its inhabitants Capitals are increased by parsimony, and diminished ... excess of banking which has of late been complained of both in Scotland and in other places The Bank of England is the greatest bank of circulation in Europe It was incorporated, in pursuance of an...
- 75
- 416
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha chỉ tiêu chất lượng 9 tr 25