Magnetic, electronic, and structural characterization of

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 Torres AM, Tsampazi ... assigned and integrated, with concomitant cycles of structure calculations for evaluation of distance and angle constraint violations as well as assignments of additional peaks based on the preliminary...
  • 12
  • 290
  • 0

Báo cáo khoa học: Functional and structural characterization of novel mutations and genotype–phenotype correlation in 51 phenylalanine hydroxylase deficient families from Southern Italy docx

Báo cáo khoa học: Functional and structural characterization of novel mutations and genotype–phenotype correlation in 51 phenylalanine hydroxylase deficient families from Southern Italy docx
... analysis of the PAH gene in 51 unrelated HPA patients from Southern Italy In addition to the molecular epidemiology of PAH mutations, we characterized the functional properties of two novel mutations ... phenylalanine hydroxylase deciency in Southern Italy: a 96% detection rate with ten novel mutations Ann Hum Genet 71, 1 8519 3 10 Waters PJ (2003) How PAH gene mutations cause hyper-phenylalaninemia and ... analysis of novel mutations Among the mutations identied in our HPA population, two (i.e p.Q301P and c.707-2delA) were novel One of these mutations, p.Q301P, arises from the c.911A>C transversion in...
  • 12
  • 234
  • 0

hydrothermal synthesis and structural characterization of fe2o3sno2 nanoparticles

hydrothermal synthesis and structural characterization of fe2o3sno2 nanoparticles
... the hydrothermal conditions are: x # 0:2 for Sn4þ in the a-Fe2O3 and x $ 0:7 for Fe3þ in SnO2 This paper is the first report on the hydrothermal synthesis and structural characterization of (1 ... with coordinates of ð0; 0; zÞ occupy 2/3 of the octahedral holes in successive oxygen layers, and 1/3 of the octahedral holes with coordinates of ð0; 0; 0Þ are empty In the case of our samples, ... decomposition at 873 K, in the presence of a few percent of (SO4)22 Figs 11 and 12 show the particle morphology and stoichiometry determined by SEM and EDX examinations of the hematite-tin oxide system...
  • 9
  • 237
  • 0

Báo cáo khoa học: Biochemical and structural characterization of mammalian-like purine nucleoside phosphorylase from the Archaeon Pyrococcus furiosus pptx

Báo cáo khoa học: Biochemical and structural characterization of mammalian-like purine nucleoside phosphorylase from the Archaeon Pyrococcus furiosus pptx
... inosine and guanosine This paper describes the cloning, recombinant expression and structural and functional characterization of purine nucleoside phosphorylase from the hyperthermophilic archaeon ... with the native state of the protein We then carried out the characterization of the thermal properties of the mutant in comparison with those of PfPNP The results obtained indicate that the substitution ... Enzyme assay Purine nucleoside phosphorylase activity was determined following the formation of purine base from the corres- Purine nucleoside phosphorylase from P furiosus ponding nucleoside by...
  • 14
  • 186
  • 0

Báo cáo khoa học: Synthesis and structural characterization of a mimetic membrane-anchored prion protein doc

Báo cáo khoa học: Synthesis and structural characterization of a mimetic membrane-anchored prion protein doc
... complimentary mutagenic primers (IDS1 2A, 5¢CGATGGAAGAAGGTGCTGAGAATTCGAAGC-3¢ and IDS12B, 5¢-GCTTCGAATTCTCAGCACCTTCTTCCA TCG-3¢) were synthesized and purified by MWG-Biotech AG (Ebersberg, Germany) ... spectropolarimeter (Jasco UK, Great Dunmow, UK) The bandwidth was nm and the scanning speed was 200 nmÆmin)1 with a response time of s and a data pitch of 0.5 nm Typically, 16 spectra were averaged and ... resolution of cm)1 and are an average of 1024 spectra collected at room temperature (21 °C) The water vapour signal was removed from the spectra and peak fitting was performed using grams software (ThermoGalactic,...
  • 15
  • 218
  • 0

Báo cáo khoa học: Isolation and structural characterization of the Ndh complex from mesophyll and bundle sheath chloroplasts of Zea mays pptx

Báo cáo khoa học: Isolation and structural characterization of the Ndh complex from mesophyll and bundle sheath chloroplasts of Zea mays pptx
... for the Ndh membrane subcomplex The Ndh antibodies recognized the 46, 28, 18 and 12 kDa polypeptides, corresponding to the NdhH, -K, -J and -E subunits of the Ndh complex The intact Ndh complex, ... et al of the ndh genes is much higher in BS chloroplasts, and elevated amounts of the Ndh complex have been found in these plastids [18] The function of the Ndh complex is still a matter of debate ... kDa), NdhE (12 kDa), NdhF (83 kDa), NdhG (18 kDa), NdhH (45 kDa), NdhI (21 kDa), NdhJ (18 kDa), NdhK (29 kDa) The 75, 51 and 23 kDa subunits are assigned as the soluble subcomplex of the Ndh complex...
  • 12
  • 194
  • 0

Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx

Báo cáo khoa học: Identification and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus influenzae pptx
... treatment with neuraminidase (as indicated by – and +, respectively) The sialylated tetrasaccharide-containing glycoforms are indicated by an asterisk All strains were grown on media containing ... that a terminal Sial-lNnT unit is linked to the Hep I residue of the LPS inner core in the sialylated glycoform The structure of the sialylated glycoforms of the O-deacylated LPS of H in uenzae ... importance in strains that lack a capsular structure, which in itself provides serum resistance Recent data from our laboratory indicate that the ability of acapsular strains of H in uenzae to elaborate...
  • 11
  • 211
  • 0


... Parajuli IDENTIFICATION, KINETIC AND STRUCTURAL CHARACTERIZATION OF SMALL MOLECULE INHIBITORS OF ALDEHYDE DEHYDROGENASE 3A1 (ALDH3A1) AS AN ADJUVANT THERAPY FOR REVERSING CANCER CHEMORESISTANCE ALDH ... reactivity and metabolism Important Aldehyde Dehydrogenase family members ALDH3A1 and its importance in cancer chemoresistance 19 Cyclophosphamide and its mechanism of cytotoxicity ... acid by ALDH3A1 in the presence of NAD(P)+ and water Important aldehyde dehydrogenase family members Structural, kinetic and knockout studies of several human aldehyde dehydrogenase isozymes...
  • 179
  • 152
  • 0

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the ... chain and hides a large amount of the hydrophobic surface area Surface area calculations for the pentamer give a total surface ˚ ˚ area of $ 81 000 A2 with 30% ($ 24 000 A2 ) as contact area Thus, ... Human adenovirus ⁄ 12 penton base chimera C Zubieta et al Fig The hAd2 ⁄ 12 and wild-type hAd2 penton base monomers (A) Ribbon diagram of the hAd2 ⁄ 12 penton base monomer is in blue (left) and...
  • 10
  • 274
  • 0

Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf

Tài liệu Báo cáo Y học: Structural and biochemical characterization of neuronal calretinin domain I– II (residues 1– 100) Comparison to homologous calbindin D28k domain I–II (residues 1 –93) pdf
... expressed and purified the homologous domain of CR (CR I II, residues 1 1 00) [23,32] This has allowed us to analyze the biochemical and structural properties of CR I– II and to compare them with Calb I II ... I II compared to Calb I II In contrast to Calb I II, CR I II shows no tendency to dimerize and both EF-hands of CR I II bind calcium We conclude that the significant structural and biochemical ... EF-hand of CR I II has a potential high calcium affinity The principal limited proteolysis products of CR I II conveniently correspond to individual EF-hand motifs (residues 1 6 0 and 61 1 00)...
  • 9
  • 244
  • 0

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt
... b-amylase (Cys83, Cys96, Cys209 and Cys344) are homologous to those found in soybean b-amylase (Cys82, Cys97, Cys208 and Cys343) On the analogy of the soybean b-amylase, the active site of the ... for the b-amylase from C sepium using the X-ray coordinates of the soybean b-amylase (Fig 4) According to the Ramachandran plot of this model the f and c angles of most of the residues are in the ... Inhibition of the enzyme activity by glucose, maltose and cyclohexaamylose For the study of the enzyme inhibition by glucose, maltose and cyclohexaamylose b-amylase activity was measured using the iodine...
  • 11
  • 273
  • 0

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx
... analysis The 105 000 g supernatant of lungfish liver (lane 1), skeletal muscle (lane 2), intestine (lane 3), lung (lane 4), brain (lane 5), adipose tissue (lane 6), heart (lane 7) and skin (lane ... showed that the protein is in a monomer–dimer equilibrium and that the dissociation constant is in the micromolar range for the apoprotein and in the submicromolar range for the holoprotein, as ... structures of other members of the family The molecule is depicted in strand representation, and a helices are numbered from I to IV (B) Residues Leu7, Arg8 and Phe11 from a-helix I, and Trp60,...
  • 9
  • 192
  • 0

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt

Báo cáo khoa học: Structural and functional characterization of human Iba proteins ppt
... cross-linking efciency of Iba1 and Iba2 or in the overall morphology of the generated lament bundles Calcium afnity of Iba1 and Iba2 Homodimerization and actin binding of Iba1 and Iba2 were similar ... presented here reveals functional similarities and differences between Iba1 and Iba2 We investigated Ca2+ binding and homodimerization of Iba1 and Iba2 Furthermore, F-actin binding and cross-linking ... Human Iba proteins J O Schulze et al study has revealed expression proles for most of the human transcripts and uncovered different tissuespecic expression of Iba1 and Iba2 [5] For Iba1 ,...
  • 14
  • 215
  • 0

Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures

Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures
... asymptotically the value of the band-gap of the undoped Si-nw This is another indication of how doping can modify the electronic and optical properties of the Si nanostructures Conclusions 3.2 3.4 ... systematic analysis of the effect of the B and P codoping in Si-nw, concentrating not only on the structural properties but also on how doping influences the electronic and optical properties Here, ... concentrate on the dependence of the doped Si-nw properties on the dopant concentration, we note first that on augmenting the number of atoms in the cell (thus lowering the dopant concentration),...
  • 8
  • 387
  • 0

Báo cáo khoa học: Structural characterization of N-linked oligosaccharides of laminin from rat kidney: changes during diabetes and modulation by dietary fiber and butyric acid pdf

Báo cáo khoa học: Structural characterization of N-linked oligosaccharides of laminin from rat kidney: changes during diabetes and modulation by dietary fiber and butyric acid pdf
... Nlinked oligosaccharides of laminin during diabetes and the likelihood of dietary fiber and butyric acid in modulating these changes Results Rats experimentally induced with diabetes using streptozotocin ... Kumar et al Laminin oligosaccharide changes during diabetes Table Effect of dietary fiber and butyric acid on fasting blood sugar, urine sugar, urine volume and glomerular filtration rate (GFR) ... of dietary fiber and butyric acid on total sugar, amino sugar and sialic acid content of laminin (lgÆ100 lg)1 protein) Values are average of duplicate analyses carried out on laminin purified from...
  • 13
  • 163
  • 0

Xem thêm

Từ khóa: mesoscopic model for dynamic simulations and structural characterization of cnt materialsthe use of various types of nmr and ir spectroscopy for structural characterization of chitin and chitosan04 optical magnetic and structural properties of semiconductor and semimagnetic nanocrystalsthe basic molecular and structural components of silicate clays a single tetrahedron and single octahedron b thousands of tetrahedrons and octahedrons are connected to give planes of silicon and aluminum or magnesium ions univeo glycomics profiling and structural analysis of mucin type o linked glycans0001 growth and structural characterizationgrowth and structural characterizationcloning expression purification and immunological characterization of proteins encoded by regions of difference genes of mycobacterium tuberculosistesting and spectrometric characterization of polymers3binding specificity and biological characterization of gpergper ligandsstructural characterization of drug dna complexesdesign conformational functional and physiological characterization of recombinant polymeric heme proteinsout of the green yonder molecular cloning and functional characterization of beta carotene 15 15 apos oxygenasestypes differential expression and structural modification of cspgs in various cancer typescongenital and structural abnormalities of the liverKiểm soát nội bộ chu trình bán hàng và thu tiền tại công ty cổ phần Bắc Âu.Mở rộng huy động tiền gửi tiết kiệm tại ngân hàng TMCP ngoại thương CN Quảng Nam.Mở rộng tín dụng doanh nghiệp tại ngân hàng TMCP đầu tư và phát triển Việt Nam, CN Khánh Hoà.Mở rộng tín dụng đối với doanh nghiệp tại ngân hàng thương mại cổ phần ngoại thương Việt Nam - Chi nhánh Quy NhơnMở rộng tín dụng xuất nhập khẩu tại ngân hàng liên doanh Việt Nga - chi nhánh Đà Nẵng.Nghiên cứu các nhân tố ảnh hưởng đến sự hài lòng đối với công việc của nhân viên NH TMCP bưu điện Liên Việt.những bài văn tả về cảnh đẹp của quê hươngNghiên cứu việc vận dụng chính sách kế toán tại công ty cổ phần tư vấn thiết kế xây dựng Đà Nẵng.Phân tích các nhân tố ảnh hưởng tới cấu trúc tài chính của các công ty may tại thành phố Đà Nẵng.những bài văn miêu tả về cơn mưa hay nhấtĐỊA VẬT LÍ GIẾNG KHOAN HOANG VĂN QUÝPhân tích hiệu quả sử dụng vốn tại công ty cổ phần gỗ MDF VRG Quảng Trị.Phát triển cây công nghiệp lâu năm trên địa bàn huyện Đức Cơ.Giây, thế kỉPhát triển dịch vụ giáo dục mầm non ngoài công lập trên địa bànPhát triển dịch vụ ngân hàng bán lẻ tại ngân hàng đầu tư & phát triển Việt Nam, CN Phú Tàitả người thân trong gia đình emTỐI ƯU HÓA VỀ THỜI GIAN DỰ ÁNcác bài văn miêu tra về thầy cô giáo hay nhấtCông nghệ sản xuất vang