0
  1. Trang chủ >
  2. Khoa Học Tự Nhiên >
  3. Vật lý >

A level physics 8 structure of the atom

Tài liệu High-level Expert Group on reforming the structure of the EU banking sector docx

Tài liệu High-level Expert Group on reforming the structure of the EU banking sector docx

... sheets Nonetheless, the differences in the size of the banking sector in Europe partly reflect the greater dependence on bank intermediation of the European economy, with bank credit being the main ... at consolidated level 2.3.4 Sector consolidation and the emergence of very large institutions The EU banking sector has undergone continuous consolidation (chart 2.3.13) The largest institutions ... onto the alleged degree of competition, or the lack thereof, of the sector The latter will also, and importantly, depend on the contestability of the sector, i.e the ability of new entrants to enter...
  • 153
  • 448
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C-terminal ... growth factors and proteinase inhibitors Biol Chem 380, 473–483 Kataoka H, Uchino H, Asada Y, Hatakeyama K, Nabeshima K, Sumiyoshi A & Koono M (1997) Analy- Crystal structure of the catalytic domain ... that the SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix The SEA domain...
  • 13
  • 588
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

... References Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A et al (2003) Genome sequence of Bacillus cereus and comparative analysis ... of GAB catalysis have been identified to date [12] which are based either on a single, bifunctional GAB catalyst or on a GAB catalysts pair The available biochemical data on MshB and LpxC are ... 276–280 Handa N, Terada T, Kamewari Y, Hamana H, Tame JRH, Park S-Y, Kinoshita K, Ota M, Nakamura H, Kuramitsu S et al (2003) Crystal structure of the conserved protein TT1542 from Thermus thermophilus...
  • 11
  • 710
  • 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands of oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture ... modulation amplitude, 10 G for (A) and (B) and G for (C)–(E); signal acquisition temperature, K for (A) and (B) and 25 K for (C)–(E) (A) The ferric heme complex of GmHO-1 at pH 7.0 (0.1 M, KPB) a- 1, ... absorption bands Heme catabolism by HOs of mammals, pathogenic bacteria, cyanobacteria and probably insects is considered to have a similar mechanism, because the characteristic absorption bands...
  • 16
  • 617
  • 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... during hormone activation [6] Our results, and the results of others, highlight the pleiotropic effects that TSA administration has on chromatin structure and on gene expression Materials and methods ... structure of chromatin incorporating them To see whether the increased transcription leakage observed at early addition of TSA can be explained by an accumulation of acetylated forms of histones in a ... specific histone modifications (Fig 2B) and noted an increased acetylation of histone H3 lysine residues 14 and upon early addition of TSA To monitor the acetylation status of the MMTV promoter subjected...
  • 10
  • 500
  • 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anomeric carbon which requires a pair of ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢);...
  • 11
  • 548
  • 0
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

... establish the preferred geometry of the precursor We now report the chemical synthesis, biochemical production, and solution structure of preCbnB2, and compare it with the structure of the mature bacteriocin, ... amphipathic nature of the leader peptide is likely to be critical for its export and processing Analysis of the sequences of leader peptides for type IIa bacteriocins (Table 1) indicates that an a-helix ... determine the structural basis of the inhibition of the antimicrobial activity of CbnB2 by the leader and to assist future analysis of the interaction of preCbnB2 with its ABC transporter protease, it...
  • 9
  • 519
  • 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

... specificity of Alzheimer s disease gamma-secretase identified by phenylalanine-scanning mutagenesis of the transmembrane domain of the amyloid precursor protein Proc Natl Acad Sci USA 96, 3053–3058 ... strongly hydrophobic side chains; this feature has been aptly described by Rajan et al as a Teflon coating that can surround a helix [16] in the case of a mixture of water and hexafluoroacetone hydrate, ... are also rather strong in this region: taken together, these features can point to an enhanced flexibility or possibly a break in the helix Structure calculation by a standard DYANA protocol yielded...
  • 7
  • 624
  • 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

... presence of EDTA The rough S minnesota LPS increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth ... reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic reaction was shown ... rough and smooth S minnesota was solely due to a sharp increase in the initial rate (Fig 5) A comparison of the effects of the rough and smooth LPSs of E coli and S minnesota on the oxidation of...
  • 6
  • 748
  • 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

... Crystallization and preliminary X-ray analysis of a Trx domain of human thioredoxin-like protein Acta Crystallogr 57, 1712–1714 32 Otwinowski, Z & Minor, W (1997) Processing of X-ray diffraction data ... identity, dissimilar crystal forms and dissimilar intermolecular contacts near the active site in the crystal, the conformation of the active site (-Cys-Gly-ProCys-) of the hTRXL-N determined in the ... negative) than the latter As the C-terminal region is rich in acidic amino acids, if it does have some interaction with the N-terminal domain, the mechanism of regulating the catalytic activity...
  • 9
  • 533
  • 0
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

... pivot about the stable AKAP-bound dimerization and docking domain, and to weakly associate with another part of the molecule, possibly the tandem cAMP binding domains of the regulatory subunit ... secondary, tertiary, and quaternary structure packing and stability In addition, we discuss the role of charges in function of RIIa D/D MATERIALS AND METHODS Sample preparation and NMR spectroscopy ... N-terminal amide and His2 Aspartic acids Asp27 and Asp30 show lower mean pKa values than their model pKa values This may be a general property of Asp residues, as it has been observed in another...
  • 12
  • 536
  • 0
Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt

Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt

... characterization of the Nogo -A functional domains (Eur J Biochem 271) 3513 Fig Schematic representation of the domain organization of the human Nogo -A protein (A) The domain organization of human ... fragments The Nogo -A cDNA (designated KIAA 0886) was obtained from the Kazusa DNA Research Institute (KazusaKamatari, Kisarazu, Chiba, Japan) A DNA fragment encoding a 182 residue Nogo -A fragment ... (designated as Nogo -A( 567–748); Fig 1) was generated by PCR with a pair of primers: 5¢-CG CGCGCGCGGATCCACTGGTACAAAGATTGCT-3¢ (forward) and 5¢-CGCGCGCGCCTCGAGCTAAAAT AAGTCAACTGGTTC-3¢ (reverse) A DNA...
  • 11
  • 493
  • 0
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

... asymmetric unit, and the glutamate- binding modes are identical to each other (Fig 2A) The a- carboxyl and a- amino groups of the bound glutamate are at the bottom of the pocket, and are held in this position ... was amplified by PCR from the plasmid pCY167 (Suzuki H & Yamada C, Unpublished), using forward primer 5¢-CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer 5¢-GGATCCTCGAG CTCATTTACGTTTTAAATTAATGCCGAT-3¢ ... structure of CapD in complex with di -a- l -glutamate peptide, a nonhydrolyzable analog of the substrate, is compared with that of the B subtilis GGT glutamate complex, it is apparent that CapD is a member...
  • 10
  • 375
  • 0
Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

... Shashkov, A. S., Kocharova, N .A & Knirel, Y .A (2004) Structural diversity of the O polysaccharides of the lipopolysaccharides and serological classification of Pseudomonas syringae pv garcae and ... of the OSHOAc (Fig 2) as well as of the full core oligosaccharide of P syringae pv phaseolicola GSPB 711 (Fig 5) The structure of the P syringae LPS core is similar but not identical to that of ... Knirel, Y .A & Krohn, K (1996) Immunochemical characterization of O polysaccharides composing the a- D-rhamnose backbone of lipopolysaccharide of Pseudomonas syringae and classification of bacteria into...
  • 10
  • 325
  • 0
Báo cáo khoa học: Structure of the O-polysaccharide fromProteus myxofaciens Classification of the bacterium into a newProteusO-serogroup pptx

Báo cáo khoa học: Structure of the O-polysaccharide fromProteus myxofaciens Classification of the bacterium into a newProteusO-serogroup pptx

... O-polysaccharide in a yield of 20% of the LPS weight Rabbit antisera and serological assays Polyclonal O-antisera were obtained by immunization of rabbits with heat-inactivated bacteria of P myxofaciens ... the O-polysaccharide of P myxofaciens Fig 1H NMR spectrum of the O-polysaccharide of P myxofaciens COOH of AlaLys) A relatively high-field position of the signal for C6 of GlcA showed that the ... polysaccharide using an amino-acid analyzer revealed the presence of GlcN and GalN in the ratio : as well as another amino component Sugar analysis using anionexchange chromatography demonstrated the...
  • 7
  • 345
  • 0

Xem thêm

Từ khóa: h kim m lee kh kang kn lee st 1998 exon intron structure of the human ptk6 gene demonstrates that ptk6 constitutes a distinct family of non receptor tyrosine kinase mol cells 8 4 401 7874 general structure of the sequential circuit version of an iterative circuitav level demonstrating an aneurysm of the membranous septum small arrows a laramp 197 resolution structure of the pancreatic procolipase complex inhibited by a c 11 alkylphosphonatethe legal structure of the european union as a union of statesvisualization of the atomic scale structure and reactivity of metal carbide surfaces using scanning tunneling microscopymutant cycle analysis as a tool to decipher the structure of the transition state for bindinga tool to investigate the structure of the chromophore and its environmenta new geophysical tool to investigate the thermohaline structure of the oceansthe objectives of an internal audit function and therefore the nature of its responsibilities and its status within the organization vary widely and depend on the size and structure of the entity and the requirements of management and where athe structure of the speech i have a dream by martin luther kingthe meaning and structure of the text acid precipitation a human impact on the earth systemit also shows the top view of a varactor periodically loaded between the two strip lines the layer structure of the parallel plate vthey are important in the research of material response because they provide a link between mechanical behaviour and physical structure of the materialthe structure of the entryBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam