it also shows the top view of a varactor periodically loaded between the two strip lines the layer structure of the parallel plate v
Tunable ferroelectric thin film devices for microwave applications
... coplanar waveguide (b) The side view of a parallel plate varactor (c) The photograph of top view of a varactor 82 Figure 4.3 The matching impedance of phase shifter circuit as a function of capacitance ... overcome the initial technological obstacle of fabricating parallel- plate varactors and its applications in tunable devices; to integrate the parallelplate varactors into tunable microwave devices ... grain, grain boundary and electric field lines in coplanar and parallel- plate varactors 66 Figure 3.17 Layer structure of the hybrid varactor and orientation of electrical field lines in the varactor...
- 150
- 478
- 0
Vector sum phase shifter using a quadrature magic t for application in polarization control
... Polarization of antenna The EM wave used for either communication or radar is transmitted through an antenna The polarization of the EM wave is dependent on the polarization of the antenna Antenna ... |S21| and |S31| of the circuit The |S21| and |S31| vary with V1 and V2 In addition, for each V1 and V2 voltage setting, the |S21| and |S31| are equal to each other The 23 amplitude imbalance of the ... diagram of the two- way vector-sum phase shifter Fig 2-1 shows the proposed block diagram of the two- way vector sum phase shifter In Part A two signals are generated with equal amplitude and a variable...
- 144
- 238
- 0
Tài liệu Category 6 and 5e Dynamic Angle Right/Left Patch Panels pptx
... time, you may verify product specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an important corporate asset and vigorously ... here are current as of the date of publication of this document Because we are continuously improving our products, ADC reserves the right to change specifications without prior notice At any ... Back view with cable management bar Ordering Information Description Dimensions (HxWxD) 24-port Category angle right/left patch panel, T56 8A/ B compatible Quantity: Ordering Number...
- 2
- 288
- 0
Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc
... b-strand conformation (more negative values of /), until a minimum of / is reached, after which the values start to increase again A random coil secondary structure represents a weighted average of ... in agreement with other studies [19] The small negative values of the evaluated / angles have been interpreted as an indication of preferred PII conformation for alanine The longer fragment Ab(1228) ... temperature These observations indicate that the transition towards b-strand occurs at lower temperatures in the variant peptide than in Ab(1228) This is also in agreement with the observed values...
- 12
- 287
- 0
transmission line matrix (tlm) in computational mechanics - d. de cogan, et al., (crc, 2006) ww
... Waves arise when the temporal derivative of one of these variables is proportional to the (negative of the) spatial derivative of the second, and vice versa For example, the natural choice of ... capacitance and has units (Farads) One of the simplest geometries is an arrangement of two parallel plates of area (A) , separated by a distance (L) in vacuum The capacitance is then expressed as ... for the standard wave equation as a “perturbation,” positive or negative, half of which is added to the leftward-going wave and half to the rightward-going wave Cross derivative terms can also...
- 275
- 514
- 0
Báo cáo hóa học: " Efficient implementation of 90° phase shifter in FPGA" pptx
... using an additional adder for adding one as shown in Figure The setting of the carry in the tap adder eliminates the need for seven additional adders that are needed to implement the negative coefficients ... Inverter (NOT gate) 7 Adder/subtractor 24 Page of converter The phase shifts obtained are 90.7°, 89.98°, and 89.73°, respectively The data from FPGA are captured in the PC and visualized in MATLAB ... other Hardware architecture The proposed hardware architecture is shown in Figure The architecture consists of two basic blocks: coefficient add/sub and tap adder The delays are modeled as Flip-Flop...
- 5
- 303
- 0
Báo cáo nghiên cứu khoa học: " FAST CALCULATING FORMULAS OF CURRENT PASSING THROUGH GROUNDING SYSTEM OF HIGH VOLTAGE SUBSTATION WHEN LIGHTNING STRIKES AT THE GROUNDING WIRE OF TRANSMISSION LINE" pps
... transform n series two- terminals networks into one then this equivalent twoterminals network will have the characteristic matrix as follows: ATD = A1 × A2 ×K × An = An (A 1) Appling the Caylay-Hamilton ... ⎩ The two- terminals network with the characteristic matrix determined at (A. 2) is transformed inversely into T -elements equivalent circuit as in Fig A. 1 Fig A1 Equivalent Thevenin circuit Trang ... Calculation of current We consider two cases (Fig 1): Case one: When lightning strikes at the gate pole of the first substation, we have the following equivalent circuit: Fig Equivalent circuit...
- 8
- 451
- 0
Báo cáo y học: "Acute pressure overload of the right ventricle. Comparison of two models of right-left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study" doc
... pulmonary artery and left atrium, the length of the PA-LA graft is always shorter than the RA-LA graft The pressure gradient PA-LA is always higher than the RA-LA These two issues constitute an ... of violation of normality) for continuous variables and as percentages for categorical data The Kolmogorov - Smirnov test was utilized for normality analysis of the parameters The comparison of ... the tricuspid valve because of the enhanced stability and reproducibility of the pressure and volumetric data from a more complete interrogation of the RV cavity” Blood gazes samples from each...
- 10
- 337
- 0
Broadband phase shifter design for phased array radar systems
... phase characteristics of the topology and the parasitics of the components It is also caused by the mismatch between the adjacent loads The loads can be for example the SPDT switches, the adjacent ... 1.7 Array gains of 16 beams of an eight-element array for a percentage phase error with RMS value of 5º It is obvious that a small phase error directly improves the scanning accuracy It is also ... surveillance, target searching, positioning, tracking, identification and velocity monitoring, etc [3] The antennas can be passive or active In passive phased arrays, antenna elements have a central...
- 199
- 297
- 0
Transmission line and and waveguide
... Surface Waves on a Grounded Dielectric Sheet Stripline Microstrip Line The Transverse Resonant Technique 10 Wave Velocities and Dispersion Parallel Plate Waveguide 19 Parallel plate waveguide ... TE, and TM Waves Parallel Plate Waveguide Rectangular Waveguide Circular Waveguide Coaxial Line Surface Waves on a Grounded Dielectric Sheet Stripline Microstrip Line The Transverse Resonant ... TE, and TM Waves Parallel Plate Waveguide Rectangular Waveguide Circular Waveguide Coaxial Line Surface Waves on a Grounded Dielectric Sheet Stripline Microstrip Line The Transverse Resonant...
- 67
- 226
- 0
Báo cáo hóa học: " Research Article Blind Deconvolution in Nonminimum Phase Systems Using Cascade Structure" pptx
... find the MISI fluctuates at the initiation in FD algorithm due to the error back propagation In PFD algorithm, we use scalar anticausal filter in PFD and then avoid the error back propagation So the ... However, if we choose a better ϕ, it is helpful for improving performance of the algorithm For example, a suitable activation function can greatly improve the stability of the learning algorithm ... average of 100 trails Figure illustrates the comparison results of the three algorithms It shows that the performances of PFD and NG are similar, and both of them are better than FD algorithm That...
- 10
- 229
- 0
microwave circuit modeling using electromagnetic field simulation
... here are predominantly of a wave nature, specifications are often given in terms of scattering rather than impedance or admittance parameters prevalent in classical circuit and network theory The ... impedances and electrical lengths The software might use a Y-matrix, a cascade of ABCD parameter blocks, or a cascade of S-parameter blocks for the actual analysis At the ports, we typically ask ... library of available elements tends to limit creativity The average user sees only what is available on the toolbar of the simulator If, however, a simulator was designed to be layout centric, it...
- 488
- 730
- 0
Báo cáo sinh học: " Multivariate Bayesian analysis of Gaussian, right censored Gaussian, ordered categorical and binary traits using Gibbs sampling" pptx
... Gaussian traits, with their censoring indicators, observed categorical and binary traits of animal i An animal with a record is now defined as an animal with at least one of m traits observed of ... traits 161 animals with another pathogen The two binary traits could be dead/alive three weeks after infection (See e.g [13] for a similar assumption in a bivariate analysis of two quantitative ... Simulated data The simulated data consist of records on five-thousand animals First the complete data consisting of a Gaussian, a right censored Gaussian, an ordered categorical, and a binary trait are...
- 25
- 166
- 0
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 2
... Declaration I hereby declare that this thesis is my original work and it has been written by me in its entirety, under the supervision of Prof Stephan Jaenicke, (in the laboratory catalysis lab ... S5-04-04 and S5-02-02), Chemistry Department, National University of Singapore, between August 2008 and December 2012 I have duly acknowledged all the sources of information which have been used in the ... the thesis This thesis has also not been submitted for any degree in any university previously The content of the thesis has been partly published in: H H Liu, G K Chuah, S Jaenicke*, N-alkylation...
- 2
- 324
- 1
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 1
... the activation of amines should in principle react with any available nucleophile The characteristic nucleophilicity of the amine substrate makes the transamination pathway available within the ... active than Ag surface atoms located in terrace sites in the hydrogenation of alcohols [7] and nitroaromatics [8] The active metals are usually relative expensive, and more of the less saturated ... subsurface oxygen It is generally accepted that the particularly high activity and selectivity of silver for these reactions is due to its ability to activate molecular oxygen in a variety of ways...
- 221
- 658
- 0
Sự khác biệt giữa LEFT JOIN , RIGHT JOIN , INNERJOIN
... dòng không ứng v i dòng bảng thứ hai (Orders) Nếu có dòng bảng Employees không ứng v i dòng bảng Orders dòng tính kết trả v : Name Hansen, Ola Svendson, Tove Svendson, Stephen Svendson, Stephen ... dòng bảng Orders không ứng v i dòng bảng Employees dòng tính kết trả v : Name Hansen, Ola Svendson, Stephen Svendson, Stephen V dụ: Ai đặt hàng máy in: SELECT Employees.Name FROM Employees INNER ... V dụ: Tìm xem đặt hàng máy in: SELECT Employees.Name FROM Employees, Orders WHERE Employees.Employee_ID = Orders.Employee_ID AND Orders.Product = ‘Printer’ kết trả v : Name Hansen, Ola Sử...
- 3
- 13,035
- 29
Báo cáo khoa học: An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel docx
... KcsA channel Table DNA sequence of the synthesized rhcc gene ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATT TGA GAATTCTCATTAAATTGACGCCAGGATGGT-3¢ ... KcsA–RHCC at pH and 8, respectively The open and closed states are indicated at the bottom of the chart NPo values at pH and are indicated above the graphs They are indicative of the mean levels ... domain imparts extreme thermostability to the KcsA channel pET15b ⁄ RHCC We also thank Drs Richard M Epand, Raquel Epand and Vettai S Ananthanarayanan, McMaster University, for usage of CD spectrometers;...
- 11
- 395
- 0
Báo cáo khoa học: "Left-to-Right Target Generation for Hierarchical Phrase-based Translation" doc
... for the foreign language side γ As an alternative to a binarized form, we present a target-normalized hierarchical phrasebased translation model The model is a class of a hierarchical phrase-based ... what types of phrase-based rules employed in a grammar, we will be able to simulate a phrasebased translation model with various constraints This reduction is rather natural in that a finite state ... from The Health and Welfare Ministry has decided to invoke the Disaster Relief Law in extending relief measures to the village and the city of Niigata The Health and Welfare Ministry in that the...
- 8
- 232
- 0
Báo cáo khoa học: "DETERMINISTIC LEFT TO RIGHT PARSING OF TREE ADJOINING LANGUAGES*" ppt
... captures the generalization of the nature of the derived trees of a CFG to the nature of derived trees of a TAG From Thatcher (1971), we can observe that the path set of a CFG (i.e the set of ... two machines are dual of each other LR Parsing Algorithm An LR parser consists of an input, an output, a sequence of stacks, a driver program, and a parsing table that has three parts (ACTION, ... is a tree, dot is the address of the dot, pos is the position of the dot (la, lb, or rb) and stars is a list of nodes in a annotated by a star Given a dotted tree with the dot above and to the...
- 8
- 218
- 0
From business strategy to IT action right decisions for a better bottom line
... reduction) The answer to this question also demands a clear and common view of overall company objectives and strategies IT managers need a common view with the senior manager team, and typically this ... Washington University and Tilburg University courses also have had a considerable impact on our thinking, as they have often heard our ideas first and served as a valuable crucible in improving ... He has worked with a large number of clients in the USA, Canada and Europe on critical IT measurement and management issues Mr Walton applies a combination of active research and practical experience...
- 354
- 577
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25