a tool to investigate the structure of the chromophore and its environment
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
Ngày tải lên :
19/02/2014, 17:20
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
- 12
- 616
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
Ngày tải lên :
22/03/2014, 12:20
... measured. Another disadvantage is the large amount of pairwise comparisons if many criteria exist. 2.6. Determination of alternatives Based on the constraints and objectives of the problem and ... The responsibility of the scientists is to screen among these alternatives the feasible measures based on applicability and suitability for the local conditions. 2.4. Evaluation criteria After the problem and its constraints have ... January and accounts for 75% to 85% of the total yearly rainfall, whereas the dry season lasts up to 6 months, from February to July and occupies only 15‐25% of the total rainfall. ...
- 13
- 487
- 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
Ngày tải lên :
20/06/2014, 15:20
... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... (Table 2), and their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 1000 statements on people’s Riazi et al Health and Quality...
- 8
- 492
- 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
Ngày tải lên :
09/08/2014, 01:24
... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... node spread and vascular invasion were still significant in a stepwise multivariate analysis for all invasive carcinomas and the subgroup of IDC (Table 2) Further univariate analyses revealed no ... breast ductal carcinoma: pathologic correlations and prognostic implications Hum Pathol 2001, 32(1):89-94 Sasano H, Frost AR, Saitoh R, Taniyama Y, Nagura H, Matsunaga G, Takehana K, Kimura M,...
- 9
- 423
- 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
Ngày tải lên :
11/08/2014, 05:21
... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and ... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument...
- 9
- 506
- 0
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
Ngày tải lên :
11/08/2014, 16:20
... noted that the tool seemed to be geared to a more formal type of organization Furthermore, the tool was focused on management and policy research, not the clinical practice research and the health ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and ... discussion that took place as a result of the item on the tool, rather than the actual score assigned The tool was less useful in the government sector, suggesting that additional tailoring of the instrument...
- 9
- 412
- 0
Báo cáo y học: " Study protocol: The development of a pilot study employing a randomised controlled design to investigate the feasibility and effects of a peer support program following discharge from a specialist first-episode " pdf
Ngày tải lên :
11/08/2014, 16:22
... between the PSW and the participant will take place on-site with the case manager and the peer support coordinator present The nature of the intervention will be explained again and both the participant ... in a treatment questionnaire (see below) and via a telephone call made by the RA to the new treating clinician asking about attendance at appointments and medication adherence These treatment adherence ... when and how to allocate their hours per fortnight and it is anticipated that while most time will be spent face -to- face, a small proportion will also be allocated to phone and email contact The...
- 7
- 443
- 0
A study to investigate the involvement of nadph oxidase 5 (NOX5) in resveratrol (RSV) induced reactive oxygen species (ROS) production in u937 cells
Ngày tải lên :
26/09/2015, 10:44
... (catalytic) and gp22 (regulatory) and cytosolic subunits p47, p67 and Rac (Kawahara et al., 2007; Lambeth, 2004; Lambeth et al., 2007) The assembly of the membrane-bound and cytosolic subunits, constitutes ... metalloproteinases (MMPs) that leads to the remodeling of extracellular matrix (ECM) and The activation of ion channels such as Ca2+ ion channels that result in cellular migration and contraction (Touyz and ... crucial in promoting cell survival/ proliferation and angiogensis (UshioFukai and Nakamura, 2008) The ROS produced mediates the activation of Ras and Erk 1/2 kinase that leads to the phosphorylation...
- 110
- 528
- 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2
Ngày tải lên :
14/09/2015, 14:01
... of the center of the cavity to the surface is h The major and minor axis of the cavity are denoted ˆ as a and b respectively a y -axis is pointing perpendicularly out of the image plane 122 The ... slab Slab thicknesses are indicated in the graph Data are calculated based on the EM theory of a 3-layers stratified system Dielectric constants of Au are evaluated using the experimental data ... sides of the layer and the SPP energy density is enhanced because of a lateral compression of the SPP wavelength due to a gradual increase in the phase velocity of the SPP as it approaches the...
- 163
- 449
- 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 1
Ngày tải lên :
14/09/2015, 14:02
... colleagues at Laboratory of Optical Imaging and Photodynamic Therapy in the National Cancer Centre, namely Dr Patricia Thong, Ms Ramaswamy Bhuvaneswari, Mr William Chin and Ms Lucky Sasidharan, and ... 12 A schematic sketch of the cavity system considered in this chapter The distance of the center of the cavity to the surface is h The major and minor axis of the cavity are ˆ denoted as a and ... in the folding and stabilization of a protein (42, 43) These bonds are generally weak in the infrared but are Raman-active Other questions answerable by the Raman technique are related to ligand...
- 129
- 265
- 0
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf
Ngày tải lên :
06/03/2014, 21:20
... and livestock products A. K Chapagain and A. Y Hoekstra – July 2003 14 The water needed to have the Dutch drink coffee A. K Chapagain and A. Y Hoekstra – August 2003 15 The water needed to have the ... World Water Week 2007 in Stockholm, the WBCSD launched the Global Water Tool, a free and easy -to- use tool for businesses and organizations to map their water use and assess risks relative to their ... on the Zambezi basin A. Y Hoekstra, H.H.G Savenije and A. K Chapagain − March 2000 The water value-flow concept I.M Seyam and A. Y Hoekstra − December 2000 The value of irrigation water in Nyanyadzi...
- 46
- 959
- 0
ENVIRONMENTAL ACCOUNTING - A TOOL USED BY THE ENTITY FOR DETERMINING ENVIRONMENTAL COSTS docx
Ngày tải lên :
29/03/2014, 14:20
... and fines and penalty tax deductible and will increase the number of environmental activities, which makes the tax treatment to be an important tool in changing attitudes towards environmental ... past and future-oriented tools: Table no.3 Past and future oriented EMA tools EMA MEMA PEMA Past oriented tools Future oriented tools Past oriented tools Future oriented tools Annual environmental ... indicators, calculating indicators, calculating management systems projects savings, budgeting and savings, budgeting and and and condensing investment appraisal investment appraisal of performance...
- 11
- 473
- 0
Báo cáo khoa học: "Computational structure of generative phonology and its relation to language comprehension." pdf
Ngày tải lên :
31/03/2014, 18:20
... either or L e m m a 4.1 Autosegmental representations can enforce the S A T constraints P r o o L The idea of the proof is to encode negation and the truth values of variables in features; to ... represents a level of the ATM computation tree The transitions of the ATM computation axe encoded in a block B as follows An AND- transition is simulated by a triple of rules, one to insert a copy of the ... when the ATM computation halts and accepts If, on the other hand, the surface form contains any nonhalting or nonaccepting units, then the ATM does not accept its input w in polynomial time The...
- 8
- 429
- 0
A computational study to investigate the effects of insulation and EGR in a diesel engine
Ngày tải lên :
05/09/2013, 16:11
... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... wall and the other spreads itself to the whole area of the glow plug channel At high loads, we observe that the main part of soot formation takes place in the prechamber due to low swirl ratio and...
- 20
- 643
- 0
báo cáo hóa học:" Development of the ATAQ-IPF: a tool to assess quality of life in IPF" doc
Ngày tải lên :
20/06/2014, 16:20
... patients and not necessarily to patients with other forms of lung disease Further, including only items that fit the Rasch model guarantees each of the ATAQ-IPF’s scales (domain and total) maintain their ... items (in their domains and in aggregate) to Rasch analysis The retained items–by virtue of fitting the Rasch model, like all items that fit the Rasch model–are guaranteed to have the same measurement ... clusters of retained items within each of the 14 individual domains and then on the resultant item pool in its entirety after item elimination at the domain level In Rasch analysis, a mathematical...
- 9
- 719
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
Ngày tải lên :
11/08/2014, 00:23
... information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching ... ‘chemotherapy and radiotherapy’ are indicated in the branch of the ‘fishbone’ that shows the cause of ovarian failure, a potential cause for secondary amenorrhea/oligomenorrhea (Figure 1) The cited ... brainstorming sessions and search in the literature to find the potential causes, then categorize these causes in an Ishikawa diagram The Ishikawa diagram can then be kept by individual learners...
- 3
- 381
- 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
Ngày tải lên :
24/09/2012, 17:19
... propriety assets According to him, Brand loyalty has to with the level of devotion a consumer has to a brand Brand awareness has to with the ability of a potential buyer to identify a brand among a product ... brand awareness: • Involve a slogan or jingle: a slogan is a visible feature of a brand There can be a strong link between a slogan and a brand The slogan and jingle are powerful and can be a ... enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has to a brand” Yoo and Donthun (2001) also...
- 88
- 986
- 8
Indoor tests to investigate the effect of brine depth on the performance of solar still
Ngày tải lên :
05/09/2013, 16:10
... series to supply a total current of 4.5 A, a voltage of 220 V and a total power flux of approximately 1000 W/m² to simulate the solar radiation intensity A variac was used to regulate the input ... Mallikarujanan KVS, and Karthikeyan N Concentrated Parabolic Solar Distiller with latent heat storage capacity International Journal of Chemical Engineering and Applications (2011) 185-188 [2] Horace ... replacing the power input from solar radiation by suitable variable heating system The indoor tests allow a greater control on the input power and eliminate many factors that may affect the accuracy of...
- 8
- 534
- 0
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
Ngày tải lên :
07/03/2014, 12:20
... [25] The costimulation of phospholipases such as PLC and PLA2 by heat shock and the resultant release of lipid mediators could also enhance the subsequent membrane association and activation of ... [13] The overexpression of a desaturase gene in Saccharomyces cerevisiae, or the addition of exogenous fatty acids, can change the unsaturated ⁄ saturated fatty acid ratio and exert a significant ... Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a key mediator of both mitogenic and stress signaling pathways,...
- 10
- 452
- 0