0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Characterization of rab22b, an astroglia enriched rab GTPase, and its role in golgi and post golgi membrane traffic

Characterization of rab22b, an astroglia enriched rab GTPase, and its role in golgi and post golgi membrane traffic

Characterization of rab22b, an astroglia enriched rab GTPase, and its role in golgi and post golgi membrane traffic

... CHARACTERIZATION OF RAB2 2B, AN ASTROGLIAENRICHED RAB GTPASE, AND ITS ROLE IN GOLGI AND POST -GOLGI MEMBRANE TRAFFIC NG, EE LING B APP SC (HONS) (QUEENSLAND UNIVERSITY OF TECHNOLOGY) ... 1.1 An overview of Rab GTPases and membrane trafficking The enormous flux of membrane traffic within a cell at any point of its existence necessitates stringent control of both the rate and specificity ... regulation of trafficking of membrane components by Rab2 2B may play an important role in myelin formation and maintenance in oligodendrocytes 26 Aims and rationale of current work 1.3 Aims and rationale...
  • 188
  • 356
  • 0
Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot

Báo cáo khoa học: Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae pot

... Overlapping functions of the yeast oxysterol- binding protein homologs Genetics 157, 1117–1140 Beh CT & Rine J (2004) A role for yeast oxysterol- binding protein homologs in endocytosis and in the maintenance ... provided invaluable insights into understanding the function of this family of proteins in yeast and offered guidance to future research On the other hand, although the entire Osh protein family shares ... detailed characterization of Osh6p, one of the seven OSBP homologs in yeast We show, for the first time, a direct binding of PA by the ORD domain and the cellular location of Osh6p We further demonstrate...
  • 13
  • 584
  • 0
Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

... analysis The 105 000 g supernatant of lungfish liver (lane 1), skeletal muscle (lane 2), intestine (lane 3), lung (lane 4), brain (lane 5), adipose tissue (lane 6), heart (lane 7) and skin (lane ... showed that the protein is in a monomer–dimer equilibrium and that the dissociation constant is in the micromolar range for the apoprotein and in the submicromolar range for the holoprotein, as ... structures of other members of the family The molecule is depicted in strand representation, and a helices are numbered from I to IV (B) Residues Leu7, Arg8 and Phe11 from a-helix I, and Trp60,...
  • 9
  • 445
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human AUH protein was first recognized by its ... confirmation of AUH deficiency in fibroblast homogenates In summary, our data show that the main biological function of AUH in human metabolism is the hydration of (E)-3-MG-CoA to (S)-HMG-CoA in the leucine...
  • 11
  • 625
  • 0
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt

... describes the relationship between the heme core description and the spectroscopic and redox properties of each identified heme from the NrfHA complex Conclusions D desulfuricans ATCC 27774 ccNiR ... this communication, we report for the first time the isolation and biochemical characterization of D desulfuricans ATCC 27774 ccNiR subunits The stoichiometry between NrfH and NrfA is discussed The ... (2003) Cytochrome c nitrite reductase ˜ from Desulfovibrio desulfuricans ATCC 27774 The relevance of the two calcium sites in the structure of the catalytic subunit (NrfA) J Biol Chem 278, 17455–17465...
  • 12
  • 593
  • 0
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

... thioredoxins were found In this study we examined the involvement of the peroxiredoxin Bcp2 in oxidative stress in the hyperthermophilic aerobic archaeon Sulfolobus solfataricus Furthermore, ... clarified in detail and could play a key role in the detoxification processes In this study we examined the role of Bcp2 in order to increase the knowledge of the enzymatic activity involved in the oxidative ... Furthermore, we report the cloning, the expression and the characterization of the recombinant protein rBcp2 in order to shed light on its role in the detoxification process and on its catalytic mechanism...
  • 11
  • 565
  • 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...
  • 12
  • 561
  • 0
Báo cáo Y học: Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod pdf

Báo cáo Y học: Purification and characterization of novel kininogens from spotted wolffish and Atlantic cod pdf

... N-Terminal sequencing of the kininogens was only successful from the 42-kDa band of wolffish kininogen (XLVQPGVLI…, Table 1) The major bands of both kininogens and also the 60-kDa band of cod kininogen ... biantennary and triantennary N-glycans, with extensive sialic acid O-acetylation Also O-glycosidic glycans were recovered from wolffish kininogen The permethylated O-glycan pool was analysed by MALDI-TOF ... N-glycans Ó FEBS 2002 Novel kininogens from cod and wolffish (Eur J Biochem 269) 2643 Fig Alignment of peptides from cod kininogen (COD KIN) and wolf fish kininogen (WF KIN) with heavy chain of human...
  • 8
  • 428
  • 0
Báo cáo khoa học: Characterization of D-amino-acid-containing excitatory conotoxins and redefinition of the I-conotoxin superfamily pot

Báo cáo khoa học: Characterization of D-amino-acid-containing excitatory conotoxins and redefinition of the I-conotoxin superfamily pot

... wells and At the same time, the activity of the muscle was recorded with a pair of electrodes: one electrode was located in the middle, and the other at one end, of the trough Each pair of recording ... from amino-acid sequences Purification and synthesis of I -superfamily conotoxins D-Amino The excitatory peptides r11b and r11c were purified from the venom of the fish-hunting species Conus radiatus ... assay r11b, r11c and their l isomers In the case of r11b, a fivefold difference was observed in potencies of the d-Phe44 and l-Phe44 forms The estimate is based on comparison of the threshold dose...
  • 11
  • 336
  • 0
Báo cáo khoa học: Characterization of mucin-type core-1 b1-3 galactosyltransferase homologous enzymes in Drosophila melanogaster pptx

Báo cáo khoa học: Characterization of mucin-type core-1 b1-3 galactosyltransferase homologous enzymes in Drosophila melanogaster pptx

... abrogating peanut agglutinin binding Furthermore, the peanut agglutinin staining in the developing nervous system documented by D’Amico and Jacobs [8] could not be confirmed in our in situ hybridization ... suggesting that some of these inactive proteins may act like cosmc as chaperones for core-1 b3GalT However, the combined coexpression of active and inactive D melanogaster core-1 b3GalT enzymes ... comprehensive testing of all core-1 b3GalT homologous genes during Drosophila development will show whether other genes are expressed in the tissues that are positive for peanut agglutinin binding Transcripts...
  • 11
  • 467
  • 0
Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins, the subcellular distribution of glycolytic enzymes ... identified in yeast) PEX17 Several other peroxins are involved in the subsequent steps of the import The import of matrix proteins seems to involve a cascade of interactions between the cargo-loaded...
  • 9
  • 549
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" docx

... the 3' NTR, we have established a new method for the generation of live flaviviruses bearing whole gene insertions between the E and NS1 protein genes Although conceptually similar to the methodology ... gene between E and NS1 We have characterized foreign gene expression and genetic stability as well as recombinant virus immunogenicity Results Design Of The Strategy For The Recovery Of Infectious ... between the E and NS1 genes must be stable to be useful for the development of new live attenuated vaccine viruses expressing antigens of other pathogens The genetic stability of the EGFP expression...
  • 16
  • 428
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Construction and characterization of recombinant flaviviruses bearing insertions between E and NS1 genes" pdf

... the 3' NTR, we have established a new method for the generation of live flaviviruses bearing whole gene insertions between the E and NS1 protein genes Although conceptually similar to the methodology ... gene between E and NS1 We have characterized foreign gene expression and genetic stability as well as recombinant virus immunogenicity Results Design Of The Strategy For The Recovery Of Infectious ... between the E and NS1 genes must be stable to be useful for the development of new live attenuated vaccine viruses expressing antigens of other pathogens The genetic stability of the EGFP expression...
  • 16
  • 422
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Characterization of the IFN-γ T-cell responses to immediate early antigens in humans with genital herpes" doc

... able to identify cytotoxic responses to several HSV antigens[ 14,15]; however, in humans there has been no correlate of the specificity of immune responses with the control of the disease Of the ... identification of the type and specificity of the T-cell responses that hold particular importance for control of the disease A full understanding of the cellular immune responses in humans infected with ... Peptides of 10, 14 or 18 amino acids in length were synthesized to contain the epitope defined for VP22 Using concentrations of 10, 3, and 0.3 ug/ml of peptides, the response of subject 14 to the...
  • 15
  • 329
  • 0
Báo cáo nghiên cứu khoa học:

Báo cáo nghiên cứu khoa học: " CHARACTERIZATION OF PROTEASE FROM ASPERGILLUS ORYZAE SURFACE CULTURE AND APPLICATION IN FISH SAUCE PROCESSING" pps

... maximum 3.3 Application of fungal protease in fish sauce processing In fish sauce fermentation, proteolysis is carried out by enzyme sources: protease in the digestion systems of fish and the protease ... the protease activity Figures and show the influence of some popular ions in food processing to the relative activity of protease from A oryzae surface culture Fe3+, Zn2+, Ca2+ and Mg2+ in sulfate ... Vmax were determined by Lineweaver – Burk method [1] 2.4 Application of fungal protease in fish sauce processing Each sample contained 100g anchovy fish The purified protease from A oryzae was added...
  • 6
  • 459
  • 1

Xem thêm

Từ khóa: preparation and characterization of nanostructured tio2 thin films by hydrothermal and anodizatithe circuitry of the human spinal cord its role in motor controlthe circuitry of the human spinal cord its role in motor control and movement disordersimportance of tourism industry and its role in the philippine economyoverview of nursing research and its role in evidence based practicesignaling—the initiator of tumor formation—and its role in regulation of c mycquot bystander effect quot and its role in the breakdown of self tolerance a positive regulator of the onset of autoimmunityan exact method for characterization of grain shapec 1 physical characterization of the set up for an enantioselective synthesisphysicochemical characterization of interfacescharacterization of the reservoir rockimplementing a characterization of genrethe cost of raising an additional rupee of capital is calledin the sequence of integers an an1an2school of planning an architectureNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI