c 1 physical characterization of the set up for an enantioselective synthesis

Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue speciﬁc expression and characterization of the lung isoform ppt

Ngày tải lên : 17/03/2014, 09:20

... GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc ... CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctggtcagcggaggagctggccccctc 864 Q Y V P Q G P ♦ (245) tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc ... cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 10 08 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag 10 58 B -20 AGCAGCCTGGACCTGCCAAG -1 ATGCTCCATCTGCTGGCGCTCGCCCTCCTGCTGAGCCTGGTCTCCGCAGCCCCTGGCCAGGCCCTGCAGCGC...

11
527
0

Báo cáo khoa học: Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli pot

Ngày tải lên : 07/03/2014, 16:20

... sequencing using the primers 5¢-AGCAATACGCTCCGCCAG-3¢, 5¢-TGGCGGATGCCAACGTAG-3¢, 5¢-CTCGACCGCGA ACACTAC-3¢, 5¢-CACCCAACTCTGCATCTTC-3¢, 5¢-TT TCGAACGCCCACGGC-3¢ and 5¢-TGTACTGAAATACC GCGCC-3¢ Expression ... viomycin (lanes 3–5), tetracycline (lane 9), thiostrepton (lane 10 ) and micrococcin (lane 11 ) inhibited pppGpp synthesis compared to control reactions carried out in the absence of antibiotics (lanes ... showing the inhibitory effects of viomycin, 0 .1 mM (lane 3), mM (lane 4), 10 mM (lane 5); tetracycline, (0.5 mM, lane 9); thiostrepton (10 lM, lane 10 ); and micrococcin (10 lM, lane 11 ) on TC-ribosome-dependent...

11
446
0

Báo cáo hoa học: " Research Article Summation Characterization of the Recessive Solution for Half-Linear Difference Equations" doc

Ngày tải lên : 21/06/2014, 20:20

... This research is supported by the Grant 2 01/ 07/ 014 5 of the Czech Grant Agency of the Czech Republic, and the Research Project MSM002 216 2409 of the Czech Ministry of Education References ˇ a P ... − 1 − Φ 1 w /Φ 1 r Φ 1 w xk r Δx Φ 1 − x Δx Φ 1 r Δx Φ 1 w Φ 1 r − 1 Φ r Φ 1 w 5 .16 14 Advances in Diﬀerence Equations Since the function x −→ − Φ 1 x Φ 1 r Φ 1 r Φ 1 x 5 .17 is increasing for ... for a certain nonlinear function which appears in the Picone-type identity for 1. 1 The recessive solution of 1. 1 is a discrete counterpart of the concept of the principal solution of the half-linear...

16
244
0

Uncommon Sense: Out of the Box Thinking for An In the Box World

Ngày tải lên : 15/03/2014, 16:07

... The Lull Before – Smarter Machines? Byte 50 – Sleep? 11 1 11 5 11 9 12 3 12 7 13 2 13 7 14 1 14 5 14 9 15 4 15 9 16 4 16 8 17 2 17 6 18 0 18 4 18 9 19 3 19 7 203 208 212 216 222 227 2 31 Index 235 viii The signiﬁcant ... Influence and degrees of separation… and distance to information and expertise Separation 10 Number of people you know or can email 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 2 10 4 10 6 10 8 10 10 10 3 10 6 10 9 10 4 10 8 ... reducing descriptions and explanations to the simplest level so we can communicate quickly and others can understand sufﬁciently, insults the depth of the problem and blankets the audience in...

251
1.5K
0

Báo cáo Y học: Cloning and characterization of the mammalian-speciﬁc nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc

Ngày tải lên : 23/03/2014, 21:20

... TTCGAGgtgagcaacccccca 309 2647 bp (exon 2, 17 7 bp) … CACCAGgtcagctgggcctca 423 418 bp (exon 3, 11 4 bp) … CCAAAGgcaagtgactttgca 4 01 bp (exon 4, 72 bp) 495 … CTTGAGgtaagctctctaaca 3 71 bp (exon 5, 10 5 ... tggtatgtgtgtcagATGCTG … )10 2 424 gcctttgctttgcagAGCCCC … 496 ttccttctggagcagGGTCTC … 6 01 tttcttgtgttgcagGTGGAT … 13 2 Fig Northern blot analysis of the human and murine NICN1 genes Membranes containing lg ... (5¢-CAT CACCACTGTGGCTGTC-3¢) and NICN1_R555 (5¢-CTCTGTCAGTGCCCACATC-3¢) and an annealing temperature of 60 C This experiment was performed two times independently In control experiments glyceraldehyde3-phosphate...

6
450
0

Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx

Ngày tải lên : 17/02/2014, 14:20

... is subjected to force F and is directed at angle 1 from the horizontal If the resultant force acting on the post is to be F R, vertically upward, determine the force T in rope B and the corresponding ... Engineering Mechanics - Statics Chapter Problem 1- 16 Two particles have masses m1 and m2, respectively If they are a distance d apart, determine the force of gravity acting between them Compare this ... 2 -18 If the tension in the cable is F1, determine the magnitude and direction of the resultant force acting on the pulley This angle defines the same angle θ of line AB on the tailboard block...

1.1K
1.1K
2

Tài liệu Báo cáo khóa học: Non-speciﬁc depolymerization of chitosan by pronase and characterization of the resultant products pptx

Ngày tải lên : 19/02/2014, 12:20

... 1) The monomeric residue sequence in chitosan is of four types, -GlcN-GlcN-, -GlcN-GlcNAc-, -GlcNAc-GlcNand -GlcNAc-GlcNAc-, of which the ﬁrst is the major type and the last one results from the ... Sample CH3 C2 /C6 C3 /C5 C4 C1 -C O Chitosan LMWC (1 h) Chito-oligomers + monomer 26.843 25.5 21 25.8 31 60.906 62.942 61. 025 78.703 77.878 78.0 51 84.703 87.332 87 .14 0 10 8 .10 3 10 7.025 10 7.562 17 6.524 17 3.057 ... 2004 Chitosanolysis by pronase (Eur J Biochem 2 71) 717 Fig Infrared (IR) spectra of chitosan and LMWC Table Characteristics of chitosan and low-molecular weight chitosan (LMWC), and the percentage...

11
673
0

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

Ngày tải lên : 07/03/2014, 03:20

... products 3, and 5) suggested the cleavage of the double bond combinations C9 C1 0 ⁄ C7 ¢ C8 ¢, C9 C1 0 ⁄ C5 ¢ C6 ¢ and their symmetrical counterparts The C1 4 dialdehyde formed by cleavage of the C9 C1 0 ... bond combinations C9 C1 0 ⁄ C9 ¢ C1 0¢, C9 C1 0 ⁄ C7 ¢ C8 ¢ and C9 C1 0 ⁄ C5 ¢ C6 ¢ The formation of multiple dialdehyde products allows some conclusions to be drawn on the site preferences of OsCCD1 For ... For instance, the C1 4, C1 7 and C1 9 dialdehydes formed from lycopene and 3-OH-ccarotene arise from cleavage of the C9 C1 0 double bond, which is combined with the C9 ¢ C1 0¢, C7 ¢ C8 ¢ or C5 ¢ C6 ¢ double...

12
497
0

Báo cáo khoa học: Characterization of the bioactive conformation of the C-terminal tripeptide Gly-Leu-Met-NH2 of substance P using [3-prolinoleucine10]SP analogues pdf

Ngày tải lên : 08/03/2014, 02:21

... necessary for the biological activity of SP Conclusion The comparison of conformational spaces of cis- and transprolinoamino acid allows one to access to / and v1 angles Energy calculations can further ... higher-energy conformer (2.5 kcalÆmol )1) compared to the corresponding conformer of leucine (0.7 kcalÆmol )1) Together, we can conclude that the proline scaffold can orientate both the peptidic backbone and ... (proportion of 30% in methanol) Therefore, the selective recognition of [Pt3Leu10]SP vs [Pc3Leu10]SP by the NK -1 receptor allows us to access to both v1 and v2 angles of the bioactive conformation of...

10
433
0

Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modiﬁed conotoxin, reveals that the glycan structure is a-D-Gal-(1ﬁ3)-a-D-GalNAc pot

Ngày tải lên : 23/03/2014, 13:20

... in t1 and spectral widths of 8000 Hz and 17 5 91 Hz in the 1H and 1 3C dimensions, respectively A total of 256 summed scans were collected with a relaxation delay of 1. 3 s All 1H and 1H -1 3C correlation ... between the anomeric and H2 protons and J1,2 coupling constants of 4.25 Hz for both the GalNAc and Gal monosaccharides identify an a conﬁguration for both anomeric centers within the glycan (Table ... of 10 lL 10 % aqueous triﬂuoroacetic acid and immediately injected onto RP-HPLC and fractions collected were collected and analyzed with ESI and MALDI-MS Chemical reduction The native and synthetic...

11
563
0

Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Ngày tải lên : 30/03/2014, 10:20

... Absorbance Units ( 10 –3) B 10 11 12 13 14 15 16 17 18 19 20 ml γ 1- 218 2000 15 8kDa 15 00 66kDa 10 00 29kDa 500 0 3560 10 11 12 13 14 15 16 17 18 19 20 ml Fig Gel ﬁltration analysis of the polypeptides ... 1- 218 1- 219 His His 14 0 Yield % of 1- 218 12 0 10 0 80 60 40 20 1- 218 1- 218 HIS FLAG 1- 218 FLAG 1- 218 HIS 1- 219 1- 219 HIS FLAG 1- 219 FLAG 1- 219 HIS Recombinant polypeptide Fig Expression of the c ECD ... 5¢-ATAGTTTAGCGGCCGCTTACGGCTT CCGGCGGATGATGAGCGAG-3¢ for e1–220, or (d) 5¢ATAGTTTAGCGGCCGCTTAGTGATGGTGATGGTGA TGCGGCTTCCGGCG-GATGATGAGCGAG-3¢ for e1– 220HIS (underlined EcoRI and NotI) The PCR products...

12
394
0

Báo cáo khoa học: Biochemical characterization of the native Kv2.1 potassium channel ppt

Ngày tải lên : 30/03/2014, 20:20

... 1. 0 1. 5 NaCl (M) Protein concentration (A595) 11 1 315 1 719 212 3 i ii 2.0 1. 0 0.5 0 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 Fraction Number B Load 11 1 315 17 19 212 3 i ii Mono-S Kv2 .1 2.0 1. 0 1. 5 ... Peptide 7 61. 4375 920.4086 10 25.4747 10 90.5750 11 29.5755 12 17.5664 12 60.65 81 1357.6424 14 16.7 214 14 63.7598 15 22.7276 15 42.7425 2549.2225 7 61. 4674 920.4 511 10 25.5056 10 90.6009 11 29.6 217 12 17.5 915 12 60.6588 ... Whole cell Membrane 15 8 44 17 (55)(26) (19 ) 1. 35 kD (A) 1. 6 1. 4 1. 2 1. 0 0.8 0.6 0.4 0.2 Vo 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 Fraction Number Whole cell kDa 13 14 15 17 19 21 23...

13
330
0

Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx

Ngày tải lên : 20/06/2014, 00:20

... of the functions of the cervical spine by the examining physician (additional file 1) One hand of the physician fixes the axis of rotation on top of the head, the other hand pulls the chin in the ... Journal of Occupational Medicine and Toxicology 2007, 2 :12 http://www.occup-med.com/content/2 /1/ 12 radiologic evidence, and is combined with a well-targeted (pain) anamnesis [1- 3] Many years of practical ... medial angle of the scapula (origin of the musculus levator scapulae) and on the lateral upper margin of the scapula for the m trapezius The tests for compression and traction of the neck are...

10
575
0

Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

Ngày tải lên : 09/08/2014, 08:22

... http://arthritis-research.com/content/8/3/R 71 Figure Nucleotide, amino acid sequence and immunochemical characterization of the carboxy-terminal region of Sip1 (a) The nucleotide sequence conSip1 taining 1, 2 81 base-pairs of the cloned ... significantly among various groups of patients analysed The precise significance of the isotypes of anti-Sip1 antibodies and their potentially independent clinical role remains unclear Another ... manuscript 11 Authors' contributions 12 FD screened the library, conducted the ELISA experiments and participated in the design of the study and analysis of the data FC participated in the design of the...

8
550
0

báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

Ngày tải lên : 11/08/2014, 11:21

... 11 9 11 9 11 8 11 6 11 7 11 9 92 12 6 15 1 14 2 11 8 11 8 11 3 11 2 14 2 14 0 16 6 PFYQGHKN Figure The two coffee candidates for NDR1 protein belong to the NHL family Putative Arabidopsis orthologs of CaNDR1a/b ... [AGI:At5g05657] The accession number of the Nicotiana tabacum Hin1 coding sequence is GenBank: AB0 914 29 .1 Cacas et al BMC Plant Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 Page of 17 ... sequence from A thaliana In this study, we focused our efforts on the Cacas et al BMC Plant Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 coffee candidate for NDR1 gene and...

17
455
0

Báo cáo y học: "Characterization of the HIV-1 integrase chromatin- and LEDGF/p75-binding abilities by mutagenic analysis within the catalytic core domain of integrase" ppt

Ngày tải lên : 12/08/2014, 04:20

... 5’AGATCAGGCTGCTGCTCTTAAGAC-3’; EK170,3AA, sense, 5’-GATCAGGCTGCACATCTTGCGACAGCAGT-3’; HL1 71, 2AA, sense, 5’-AGGCTGAAGCTGCTAAGACAGC-3’; HK1 71, 3AA, sense, 5’AGGCTGAAGCTCTTGCGACAGCAGTAC-3’ The amplified HIV -1 ... (Roche diagnostics, Germany) along with forward (5’-tac tga cgc tct cgc acc-3’) and reverse (5’-tct cga cgc agg act cg-3’) primers targeted to the 5’ end of the LTR and Gag region of the HIV -1 ... sequence was CCGGGCAGCTACAGAAGTCAAGATTCTCGAGAA TCTTGACTTCTGTAGCTGCTTTTTG The lentiviral particles harboring LEDGF/p75 shRNA were produced by co-transfecting the shRNA pLKO .1 vector, packaging...

14
324
0

Báo cáo y học: "Reverse genetic characterization of the natural genomic deletion in SARS-Coronavirus strain Frankfurt-1 open reading frame 7b reveals an attenuating function of the 7b protein in-vitro and in-vivo" pptx

Ngày tải lên : 12/08/2014, 04:20

... 5'TACTAATACGACTCACTATAGATATTAGGTTTTTACC TA CCCAGG-3' and A1rev 5'-aatgccagtatgacctgagccaatatc-3' and A2fwd 5'-GATATTGGCTCAGGTCATACTGGCATT-3' and Arev 5'-ACACCATAGTCAACGATGCC-3' After correction of errors both inserts ... JinPage 11 of 17 (page number not for citation purposes) Virology Journal 2009, 6 :13 1 drich Cinatl, Universtiy of Frankfurt), human hepatoma cells HuH7 (ATCC CCL -18 5), human colonic cancer cells CaCo-2 ... overlap-extension primers 5'-GATTACAAGGATGACGACGATAAGTAAACGAACATGAAACTTCTC-3' and 5'CTTATCGTCGTCATCCTTGTAATCGACTTTGGTACAAGGTTCT-3' Assembly of full length BAC cDNA clone BAC vector pBeloBAC 11 was obtained from...

17
285
0

Báo cáo khoa học: " Reverse genetic characterization of the natural genomic deletion in SARS-Coronavirus strain Frankfurt-1 open reading frame 7b reveals an attenuating function of the 7b protein in-vitro and in-vivo" docx

Ngày tải lên : 12/08/2014, 04:20

... 5'TACTAATACGACTCACTATAGATATTAGGTTTTTACC TA CCCAGG-3' and A1rev 5'-aatgccagtatgacctgagccaatatc-3' and A2fwd 5'-GATATTGGCTCAGGTCATACTGGCATT-3' and Arev 5'-ACACCATAGTCAACGATGCC-3' After correction of errors both inserts ... JinPage 11 of 17 (page number not for citation purposes) Virology Journal 2009, 6 :13 1 drich Cinatl, Universtiy of Frankfurt), human hepatoma cells HuH7 (ATCC CCL -18 5), human colonic cancer cells CaCo-2 ... overlap-extension primers 5'-GATTACAAGGATGACGACGATAAGTAAACGAACATGAAACTTCTC-3' and 5'CTTATCGTCGTCATCCTTGTAATCGACTTTGGTACAAGGTTCT-3' Assembly of full length BAC cDNA clone BAC vector pBeloBAC 11 was obtained from...

17
346
0

Báo cáo khoa học: " The construction and characterization of the bi-directional promoter between pp38 gene and 1.8-kb mRNA transcripts of Marek''''s disease viruses" doc

Ngày tải lên : 12/08/2014, 04:21

... AAgagctcGAGCATCGCGAAAGAGAG A GAggtaccTCGAGGCCACAAGAAATT TTTggtaccGTTCGCACCAGAGTCCA GAAgagctcGAGGCCACAAGAAATT AAgagctcGAGCATCGCGAAAGAGAG A AAAggtaccGCCGAGGTGAGCCAATC The sites opposite to the ORF of pp38[4] ... http://www.virologyj.com/content/6 /1/ 212 10 11 12 13 14 15 16 Authors' contributions RC and DJB designed and performed experiments; DJB and BW analyzed the data and wrote the manuscript 17 Acknowledgements 18 This work is supported ... validate the activity of the promoter Primer Fpp38 Rpp38 F1.8 kb R1.8 kb F(d)pp38 R(d)pp38 F(d )1. 8 kb R(>d )1. 8 kb Sequence( 51- 31) AAggtaccGAGCATCGCGAAAGAGAG A GTgagctcTCGAGGCCACAAGAAATT AAgagctcGAGCATCGCGAAAGAGAG...

6
386
0

Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx

Ngày tải lên : 13/08/2014, 01:21

... Tris-Cl; pH 7.5, 1% NP-40, 0.05% SDS, 15 0 mM CGAGATCCGTTCACTAATCGAATG B GGATTAACTGCGAATCGTTCTAGC C CGAGATCCGTTCACTAATCGAATG BA1 (b-actin) CATGTGCAAGGCCGGCTTCG BA4 (b-actin) GAAGGTGTGGTGCCAGATTT ... 11 9 :15 3 -15 6 15 Spector DL: Nuclear domains J Cell Sci 20 01, 11 4:28 91- 2893 16 Cook PR: The organization of replication and transcription Science 19 99, 284 :17 90 -17 95 17 Chakalova L, Debrand E, Mitchell JA, ... 11 12 13 14 15 16 17 18 spliced (A +C, 280bp) unspliced (A+B, 372bp) Figure Detection and identification of HIV -1 RNA associated factors A) Description of the HIV -1 constructs Above an outline of...

15
470
0