implementing a characterization of genre

Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

Ngày tải lên : 14/02/2014, 03:20
... was maintained by using beryllium metal foil to seal the X-ray optical path. Table 2. Summary of DSC data, suggested results, and additional characterizations sample no. peak onsets (°C) peak ... nitrogen purge. Evolved Gas Analysis. Simultaneous TG/MS and TG/gas chromatography (GC)/MS analysis were performed on several samples. A split was used to send a fraction of the evolved gases to a quadruple mass ... TGA analysis was performed on several samples using a TA 2950 TGA with a platinum pan. A nitrogen atmosphere was used for each trial. Some analyses were performed on a Perkin Elmer-7 TGA with an...
  • 16
  • 549
  • 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Ngày tải lên : 18/02/2014, 06:20
... Meyer-Klaucke for data collection and assis- tance in data evaluation. The assistance of T. Pavkov (Institute of Chemistry, University of Graz) in the acquisition of CD and DLS data is gratefully acknowl- edged. ... B. xenovo- rans LB400 through a PCR with GAGCGG CATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGG CATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively. The primers ... depletion of a molar equivalent of dissolved O 2 . HPLC analysis of the products of the enzymatic transformation revealed that Bxe _A2 876 catalyzed breakdown of the b-diketone substrate via oxidative carbon–carbon...
  • 15
  • 624
  • 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Ngày tải lên : 18/02/2014, 08:20
... molecular basis of enzyme thermosta- bility. J Bacteriol 185, 4038–4049. 20 Nanba H, Yajima K, Takano M, Yamada Y, Ikenaka Y & Takahashi S (1997) Process for producing d-N-car- bamoyl -a- amino acid. ... molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optimal temperature for activity of HYD Js with d-p- HPH as substrate was determined ... Bommarius AS, Schwarm M & Drauz K (1998) Biocatal- ysis to amino acid-based chiral pharmaceuticals - exam- ples and perspectives. J Mol Catal B-Enzym 5, 1–11. 14 Liljeblad A & Kanerva LT...
  • 14
  • 621
  • 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Ngày tải lên : 18/02/2014, 17:20
... 2008) doi:10.1111/j.1742-4658.2008.06352.x Cone snails, a group of gastropod animals that inhabit tropical seas, are capable of producing a mixture of peptide neurotoxins, namely conotoxins, for defense and predation. Conotoxins are mainly ... and sequence of dermorphin, a novel opiate-like peptide from the skin of Phyllomedusa sauvagei. Int J Pept Protein Res 17, 275–283. 10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, ... Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but not syn- thetic omega-[L-Ser46]agatoxin-TK, exerts blockade of P-type calcium...
  • 12
  • 616
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Ngày tải lên : 19/02/2014, 02:20
... TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG 18Sfw CGCCGCTAGAGGTGAAATTC 18Srev TCTTGGCAAATGCTTTCGCT TaqMan probe 18S TGGACCGGCGCAAGACGGAC AB Fig. ... rev, reverse. Sequence ACMSD cloning: primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe 1 ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ... Ala was carried out using the QuickChange kit (Stratagene, La Jolla, CA, USA). Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATC GCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGT GCT ATTCTACCAAAAGAATGGCC-3¢...
  • 14
  • 601
  • 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Ngày tải lên : 19/02/2014, 05:20
... oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. The spectral features of the final reaction mixture were analogous, ... T, Zhang X, Sun D, Sato M, Sasahara M, Kayama T, Ikeda-Saito M & Yoshida T (2000) Histidine 20, the crucial proximal axial heme ligand of bacterial heme oxygenase Hmu O from Corynebacterium ... vanished after 30 min, and instead, an absorption peak appeared at 637 nm, suggesting the formation of CO–verdoheme. The 637 nm band disappeared gradu- ally and was replaced by a new broad band...
  • 16
  • 617
  • 0
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Ngày tải lên : 19/02/2014, 06:20
... GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C. The PCR reaction was done as described above. The amplified ... T. reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC A GT GGT GGT GGT ... oxidase, Japanese patent 61115488. 37 Yamada Y, Tawara Y & Yoshika H (1983) Production of heat-resistant polyphenol oxidase, Japanese patent 60062980. 38 Abdel-Raheem A & Shearer CA (2002)...
  • 14
  • 650
  • 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Ngày tải lên : 19/02/2014, 06:20
... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus ... addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3¢ ... pentamer give a total surface area of  81 000 A ˚ 2 with 30% ( 24 000 A ˚ 2 ) as con- tact area. Thus, a large amount of the available surface area of the molecule is buried upon pentamerization, increasing...
  • 10
  • 647
  • 0
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Ngày tải lên : 19/02/2014, 07:20
... C)AATTTC-3¢ PsCBL (degenerate forward) 45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR ... T)GC(C ⁄ G ⁄ T)AAGGT-3¢ PsCIPK (degenerate forward) 25¢-ACAAA (A ⁄ C )A( A ⁄ G) (A ⁄ G ⁄ T )A( C ⁄ T) (A ⁄ C ⁄ G)ACACCACAAGACC)3¢ PsCIPK (degenerate reverse) 35¢-CTTAT(C ⁄ G)AACAAGGAA (A ⁄ C)AATTTC-3¢ PsCBL ... Transgenic evaluation of activated mutant alleles of SOS2 reveals a critical requirement for its kinase activity and C-term- inal regulatory domain for salt tolerance in Arabidopsis thaliana....
  • 19
  • 706
  • 0
Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Tài liệu Báo cáo khoa học: Characterization of the interaction between the plasma membrane H+-ATPase of Arabidopsis thaliana and a novel interactor (PPI1) doc

Ngày tải lên : 19/02/2014, 07:20
... primers: gatggatcccatATGGGTG TTGAAGTTGTA annealing around the start codon of the Ppi1 ORF and gactcgagATTAGTCGACTTCTTACGC annealing just before the putative transmembrane domain (capital letter ... Soave C & De Michelis MI (2002) A novel interaction partner for the C-termi- nus of Arabidopsis thaliana plasma membrane H + -ATP- ase (AHA1 isoform): site and mechanism of action on H + -ATPase ... H + -ATPase activity was evaluated as the difference between total activ- ity and that measured in the presence of 100 lm vanadate (less than 10% of total activity at pH 7; less than 5% of total activity...
  • 8
  • 629
  • 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt

Ngày tải lên : 19/02/2014, 07:20
... 5¢-CTTTAACTTGTTGGGCACTGG CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢). Nested PCR was carried ... obtain the full length sequence: OP5, 5¢-GACTGTAACGGTCATGGYACMAYGT-3¢; OP6, 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG- 3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACG TG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATC GTCCC-3¢; ... PCR was performed in 50 lL containing 1 ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢ ) and downstream...
  • 14
  • 523
  • 0
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Ngày tải lên : 19/02/2014, 16:20
... pGL3e:Prm 3a AP)1 *, pGL3b:Prm3ab AP)1 *, pGL3e: Prm3ab AP)1 *, pGL3b: Prm3aa AP)1 *, pGL3e:Prm3aa AP)1 *, pGL3b:Prm3aaa AP)1 * and pGL3e:Prm3aaa AP)1 *. Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa ... Witte DP & Grabowski GA (1998) Isola- tion and characterization of the human prosaposin pro- moter. Gene 218, 37–47. 51 de Grazia U, Felli MP, Vacca A, Farina AR, Maroder M, Cappabianca L, Meco ... to aaTTCCa (core bases shown in uppercase letters) centered at )123 within Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; sense primer)...
  • 18
  • 509
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Ngày tải lên : 20/02/2014, 11:20
... alkyla- tion leading to a depletion of mtDNA in intact cells (Fig. 1). Here we report the synthesis and characterization of a novel mitochondria-targeted alkylating reagent and show that it alkylates ... presence of relaxed-circular mtDNA after digestion with ClaI may indicate alkylation of the restriction site as untreated mtDNA, or mtDNA isolated from mitoDC-81- treated mitochondria, was always ... entirely wrap mtDNA and cause a marked increase in nuclease resistance in vitro [54]. Similar targeting of PNAs to mitochondria also failed to show inhibition of mtDNA replication in intact cells...
  • 10
  • 638
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf

Ngày tải lên : 21/02/2014, 00:20
... hemolymph of P. jacquemontii by affinity chromatography. It yielded a 2000-fold increase in specific activity. Analysis of the lectin on SDS/PAGE gave a single band at apparent molecular mass of 34 kDa. The ... purification. Erythrocyte preparation Blood for HA assay was prepared as described by Ravindranath et al. [12]. Hemagglutination assay Hemagglutination assays were performed in microtiter plates (Falcon) as recommended ... & Paulson, J.C. (1985) Purification and characterization of an O-acetyl sialic acid specific lectin from a marine crab Cancer antennarius. J. Biol. Chem. 260, 8850–8856. 13. Kawai, T. Kato, A. ...
  • 8
  • 616
  • 0
Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

Tài liệu Báo cáo Y học: Identification and characterization of a mammalian 14-kDa phosphohistidine phosphatase pdf

Ngày tải lên : 21/02/2014, 01:21
... phosphatase gene. Astandard BLAST search, with AF164795 as the query, was performed against the nonredundant databases at the NCBI site. In that way, the gene of the human phosphohistidine phosphatase ... gene. EXPERIMENTAL PROCEDURES Materials Phosphoamidate was prepared according to the method of Wei and Matthews [4]. Suc-Ala-His-Pro-Phe-pNA was purchased from Bachem AG, Switzerland. Malachite green reagent ... traced by its absorbance at 315 nm, appeared as a peak at 0.33 M MDEA and was essentially stable in this buffer at +4 °C for at least 4 months. The phosphate content of the phosphopeptide was analysed...
  • 8
  • 666
  • 0