0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2

A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2

A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 2

... and Christy’s previous publication (73), 117 4.4 Surface Plasmon Polariton Assisted Surface Enhanced Raman Scattering on Ultrasmooth Metal Surface The theory for an enhanced field near a metal ... distance of the center of the cavity to the surface is h The major and minor axis of the cavity are denoted ˆ as a and b respectively a y -axis is pointing perpendicularly out of the image plane ... from the surface rather than propagating away Inside the metal (i = 2) , on the other hand, k z of the SPP will v possess a negative imaginary part (see Eqn and 7), which suggests that the E2 field...
  • 163
  • 449
  • 0
A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 1

A method for 3d nano focusing of optical energy and its application to the surface enhanced raman spectroscopic study of protein 1

... Theory of Enhanced Raman Scattering and its Experimental Verifications 2 .1 General Theory of Raman Scattering 13 2.2 Enhanced Raman Scattering 13 2.2 .1 Chemical Raman Enhancement 14 2.2.2 Electromagnetic ... Schematic diagram of SNOM system for phase measurements 17 0 17 1 Fig 15 A typical AFM and SNOM mappings of a 10 0-nm nano- cavity substrate with cavitysurface distance of (a and b) 10 nm, and (c and d) ... A Method for 3D Nano- focusing of Optical Energy and its Application to Surface Enhanced Raman Spectroscopic Study by Kiang Wei Kho SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE...
  • 129
  • 265
  • 0
Báo cáo y học:

Báo cáo y học: "Dynamic simulation of red blood cell metabolism and its application to the analysis of a pathological condition" docx

... Mathematical simulation and analysis of cellular metabolism and regulation Bioinformatics 1999, 15:749-758 Tomita M, Hashimoto K, Takahashi K, Shimizu TS, Matsuzaki Y, Miyoshi F, Saito K, Tanida ... disposable cells never reach a mathematical steady state Thus, a model that can tolerate long-term simulation for analyzing the pathology of human diseases should not approximate the "mathematical ... century Trends Biotechnol 2001, 19:205-210 Takahashi K, Ishikawa N, Sadamoto Y, Sasamoto H, Ohta S, Shiozawa A, Miyoshi F, Naito Y, Nakayama Y, Tomita M: E -Cell 2: Multi-platform E -Cell simulation...
  • 11
  • 386
  • 0
TEACHING FOR EXPERIENTIAL LEARNING AND ITS APPLICATION TO THE VOCATIONAL TRAINING OF CIVIL ELECTRICAL SERVICES FOR RURAL LABORERS

TEACHING FOR EXPERIENTIAL LEARNING AND ITS APPLICATION TO THE VOCATIONAL TRAINING OF CIVIL ELECTRICAL SERVICES FOR RURAL LABORERS

... go to substantially improve the effectiveness of the training The thesis explains the deployment of TFEL in the reform of vocational teaching activities for rural workers The analysis of the ... with the direct exchange of the contents related to the techniques and the application of experiential teaching in the VT of civil electricity job groups for rural workers with the experts, the ... process and techniques of TFEL proposed by the topic are applied, they will contribute to improving the efficiency of the VT of civil electricity for the rural labor force STUDY TASKS To study theories...
  • 28
  • 278
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Method for Word Sense Disambiguation of Unrestricted Text" potx

... untagged word1 - word2 pair (W1 - W2) OUTPUT: ranking the senses of one word PROCEDURE: STEP Form a similarity list ]or each sense of one of the words Pick one of the words, say W2, and using WordNet, ... using WordNet, form a similarity list for each sense of t h a t word For this, use the words from the synset of each sense and the words from the h y p e r n y m synsets Consider, for example, ... Contextual ranking of word senses Since the Internet contains the largest collection of texts electronically stored, we use the Internet as a source of corpora for ranking the senses of the words 3.1...
  • 7
  • 378
  • 0
Báo cáo y học:

Báo cáo y học: "DarkHorse: a method for genome-wide prediction of horizontal gene transfer" pptx

... 10:606-611 Pariasca JAT, Sunaga A, Miyazaki T, Hisaka H, Sonoda M, Nakagawa H, Sato T: Cloning of cDNAs encoding senescence-associated genes, ACC synthase and ACC oxidase from stored snow pea pods ... variability among proteins, mutation rates and database representation can also vary widely between taxa, so appropriate threshold values may need adjustment by query organism, as well as by individual ... LPImax lineage Eukaryota; Viridiplantae; Streptophyta; Liliopsida; commelinids; Poales; Poaceae; Ehrhartoideae; Oryzeae; Oryza Eukaryota; Viridiplantae; Streptophyta; rosids; Brassicales; Brassicaceae;...
  • 18
  • 480
  • 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge

... archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the laboratory-scale and the full-scale activated sludge were quantified both by the quantitative ... abundance in activated sludge Nevertheless, quantitative PCR method for Candidatus ‘Accumulibacter phosphatis’ has not been developed yet In this study, quantitative PCR method for Candidatus ‘Accumulibacter...
  • 7
  • 719
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Method for Relating Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting" pptx

... words for the articles These words show new information in the article, and make it easy to understand t h e content of the articles If a word in an article appears in the differentia words for its ... the story of the articles For example, the word "state" is the differentia word for dT, and is in its adjacent articles ds, dg, anddlo This means that d7 is a starting point of the new topic ... existence of a topic In V, for a particular topic, the in-degrees of related nodes {dT, ds, dg, dl0} is a cycle for the topic "statement." increase, since these articles are connected to each By recognizing...
  • 7
  • 419
  • 0
Báo cáo y học:

Báo cáo y học: "Statistical methods for detecting and comparing periodic data and their application to the nycthemeral rhythm of bodily harm: A population based study" ppsx

... each other revealing only two different nycthemeral rhythms We demonstrate that the nycthemeral rhythms on Friday and Saturday are equal and differ significantly from the rhythms of the other ... of the study, analyzed the data and drafted the manuscript UR contributed to the conception and the design of the study TB acquired the data IK contributed to the analysis JK contributed to the ... closely examined We investigate if the seven days of the week show different nycthemeral rhythms of bodily harm Data handling and calculations were performed by Microsoft Excel ® , Matlab ® and...
  • 10
  • 467
  • 0
báo cáo khoa học:

báo cáo khoa học: " A linkage map for the B-genome of Arachis (Fabaceae) and its synteny to the A-genome" doc

... B3 Ap32# Ar10 Figure A linkage map for the B-genome of Arachis A linkage map for the B-genome of Arachis Linkage map of Arachis based on an F2 population resultant from the cross A ipaënsis × A ... LG of the AA map, B6 with A6 and A1 0, and B7 with A7 and A8 Synteny analysis A total of 51 common markers mapped in the AA and BB genome diploid maps spanned the 10 linkage groups of both maps ... microsatellite-based map for the Bgenome of Arachis and its integration with an A- genome map The development of these maps, based on markers that are highly transferable and simple to use will facilitate the...
  • 10
  • 399
  • 0
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation

Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation

... complex The IRAK4/IRAK1/TRAF6 complex interacts at the membrane with another preformed complex consisting of TGF-βactivated kinase (TAK1) and its two adaptor proteins, TAK1-binding protein (TAB) and ... of the nature of the interactions, the temporal and spatial combinations of these interactions can generate considerable functional diversity by triggering distinct signaling cascades and leading ... Chapter 6.1 Discussion Development of a TLR -based two- hybrid assay for the detection of proteinprotein interactions 6.2 158 Investigation of CD14 dimerization and its role in CD14 signal transduction...
  • 236
  • 494
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGATAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT...
  • 12
  • 772
  • 0
Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf

Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf

... peer review to ensure that they meet high standards for research quality and objectivity Stress and Performance A Review of the Literature and Its Applicability to the Military Jennifer Kavanagh ... 198 1Stress and performance : a review of the literature and its applicability to the military / Jennifer Kavanagh p cm “TR-192.” Includes bibliographical references ISBN 0-8 33 0-3 83 0-3 (pbk : alk ... that battle fatigue and other stress reactions may account for as many as 50 percent of the casualties in a given war As a result of the effect that stress can have on service members and their...
  • 86
  • 607
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Case Analysis Method Cooperating with ATNG and Its Application to Machine Translation" pot

... equivalent to several machine- language instructions, and they refer to m e m o r y locations by names called variables." One point is N M P analysis method by recursive calling for case frame analysis ... obligatory prepositional phrase name if the verb is intransitive Furthermore, the control moves to the next case slot to fill i t , i f the case frame has more slots, all of which are obligatory case ... a case frame, while optional case slots are united in a special frame The process to fill the case slots is continuing until the end of the case frame Then, more t h a n one candidate for a case...
  • 5
  • 353
  • 0

Xem thêm

Từ khóa: chen y bicker w wu j xie m lindner w simultaneous determination of 16 nucleosides and nucleobases by hydrophilic interaction chromatography and its application to the quality evaluation of ganoderma journal of agricultural and food chema method for word sense disambiguation of unrestricted textamp 151 a new experimental method and its application in the photodissociation of small aromatic molecules cheng liang huang yuan t lee and chi kung nipreparation and properties of sio2 thin films by the sol gel method using photoirradiation and its application to surface coating for displaythe basic features of the gimf and its application to a small open oil exporter`co evolution´ and its application in the social sciences a review of the literaturea combined intelligent optimization method and its application to subsynchronous damping control in electrical power transmission systemsbasics of nuclear magnetic resonance and its application to carbon alloysfrequency transformation for linear state space systems and its application to high performancepaper solutions how do we look at exotic financial instrument innovations that are built on the portfolios of the poor and its relation to the real economyh rm reduced newline and its relation to the sigma constant of mmri measurement of cerebral water diffusion and its application to experimental researchcardiac remodeling and its relationship to the development of heart failureits application to the analysis of flavonoids in plant extract and metabolites in vivocultural intermixing the diffusion of gis and its application to coastal management in developing countrieschuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ