... then as a Ph.D student and researcher Her research areas include adaptive transform-based methods in signal and image processing, and spectral techniques Jaakko Astola received his Ph.D degree in ... NY, USA, 1995 [4] S S Agaian andA K Matevosian, “Generalized Haar transforms and automation systems for testing quality of circuits,” Acta Cybernetica, vol 5, pp 345–362, 1981 [5] N U Ahmed and ... Guevorkian, and H Sarukhanyan, “On parameterized fast Haar- and Hadamard-like transforms of arbitrary order,” in Proceedings of the 3rd International Conference on Computer Science and Information...
... synthesis and acetyl-CoA conversion pathway 46 acetyl-CoA fi acetoac-CoA + CoA 47 Acetoac-CoA + NADPH fi 3HB-CoA + NADP 48 3HB-CoA fi PHB + CoA 49 PHB fi 3HB 50 Acetoac + NADH fi 3HB + NAD 51 Acetoac-CoA ... rapid selfreproduction, gaining a maximal biomass production at a given total flux is obviously equivalent to maintaining a given rate of biomass production at a minimum of the total flux Insofar, ... b-ketothiolase Acetoacetyl-CoA reductase (NADPH) PHB synthase PHB depolymerase b-hydroxybutyrate dehydrogenase Acetoacetate-succinyl-CoA transferase D-crotonase L-crotonase Acetoacetyl-CoA reductase...
... or after quotations and inserted clauses Pause duration is normalized ina talk with its mean and variance (3) speaking rate Inside inserted clauses, speakers tend to speak fast The speaking rate ... the Association for Natural Language proceeding, pages 517–520 (in Japanese) Katsuya Takanashi, Takehiko Maruyama, Kiyotaka Uchimoto, and Hitoshi Isahara 2003 Identification of “Sentences” in Spontaneous ... Maruyama, Katsuya Takanashi, Tatsuya Kawahara, and Hitoshi Isahara 2006 Dependencystructure Annotation to Corpus of Spontaneous Japanese In Proceedings of the LREC2006, pages 635-638 Kazuya Shitaoka,...
... The Saskatchewan Health and Back Pain Survey The prevalence of neck pain and related disability in Saskatchewan adults Spine (Phila Pa 1976) 1998, 23(15):1689-1698 United States Bone and Joint ... experience of spinal pain andits related disability involves a combination of biological and psychological processes that occur within a certain social context The primary spine care practitioner ... these factors is incorporated by the primary spine care practitioner into the management of the somatic factors [63,64] An appreciation of minimalism in spine care: The primary spine care practitioner...
... by Graph Search and Matching Proe of AAAI'97, pages 622-628 Y M aa r e k andA Wecker 1994 The Librarian Assistant: Automatically Assemblin Books into Dy- 1313 namic Bookshelves Proc of RIAO K ... et al proposed the scatter/gather approach for facilitating information retrieval (Hearst et al., 1995) Maarek et al related documents by using an hierarchical clustering algorithm that interacts ... on a treaty to abolish such testing d5: The Minister of Foreign Affairs, Mr Youhei Kohno, takes a critical attitude toward China, and asks France to understand Japan's position d6: The prime minister...
... oxidoreductases Flavin-containing amine oxidases FAD-dependent oxidoreductases Zinc-containing alcohol dehydrogenases Lactate ⁄ malate dehydrogenases UBA ⁄ THIF-type NAD ⁄ FAD binding fold Flavin-containing ... ‘NAD(P)binding Rossmann-fold domain’, ‘FAD ⁄ NAD(P)-binding domain’ and ‘Nucleotide-binding domain’ The dataset was scrutinized and only proteins utilizing FAD or NAD(P) ina typical manner were used, ... Chlamydophila caviae (13 proteins), while in archaea the top and bottom is represented by Haloarcula marismortui (146 proteins) and Nanoarchaeum equitans (five proteins) The genomes of Oryza sativa and Xenopus...
... individual structures are obtained for each sentence and their meaning equivalence for each slot is proved by matching the fillersof case-instances and by doing the same for case-names Incidentally, ... case slots They are described ina m e a n i n g slot (whose v a l u e is a meaning frame) ina case frame, while optional case slots are united ina special frame The process to fill the case ... locations by names called variables." One point is N M P analysis method by recursive calling for case frame analysis In the example, two 157 there may be a little problem in lacking the case...
... across the thin layer above the cavity, ina manner akin to the focusing of a parallel light beam by a high refractive-index cylindrical lens Apart from the 2D lateral focusing, an axial compression ... in an attempt to tackle these challenges A previous approach for fabricating porous nano-structures by depositing material through a colloidal crystal template appears to be relevant to the abovementioned ... exciting surface plasmons (a) p-polarisation; (b) s-polarization 110 By assuming region to be Au with a dielectric constant as that obtained by Johnson and Christy previously (73), and setting ε and...
... deepest appreciation to my colleagues at Laboratory of Optical Imaging and Photodynamic Therapy in the National Cancer Centre, namely Dr Patricia Thong, Ms Ramaswamy Bhuvaneswari, Mr William Chin and ... had to wake up at in the morning to prepare substrates I am also indebted to Ms Iman Ahmad and Dr Srinivasan Madhavi for their assistance in preparing Au substrates I would also like to express ... for phase measurements 170 171 Fig 15 A typical AFM and SNOM mappings of a 100-nm nano-cavity substrate with cavitysurface distance of (a and b) 10 nm, and (c and d) 20 nm (a) and (c) are topology...
... CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT GCTGCCACCCGTAGGTGT Reference Lane (1991) Lane ... Quantification using Quantitative PCR and FISH methodin Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the laboratory-scale and the full-scale activated sludge were quantified ... Specificity and reproducibility with DNA extracted from activated sludge were evaluated In addition, the amount of Candidatus ‘Accumulibacter phosphatis’ in laboratory-scale EBPR and full-scale activated...
... Algorithms in Search, Optimizationand Machine Learning, Addison-Wesley, Reading, Mass, USA, 1989 [19] T Trappenberg, J Ouyang, andA Back, “Input variable selection: mutual information and linear mixing ... state and imaginative hand movement The imaginative hand movement can be hand closing or hand opening From 200 data sets, 100 sets are randomly selected for training, while the rest is kept aside ... are based on the idea that a linear projection on the data is applied that maximizes the mutual information between the transformed features and the class labels Finding the linear mapping was...
... search tool,” Journal of Molecular Biology, vol 215, no 3, pp 403–410, 1990 I H Witten and E Frank, Data Mining: Practical Machine Learning Tools and Techniques, Morgan Kaufmann Series in Data ... that the two methods for estimating marginal probabilities are complimentary (4) As with sequence-based classification, introducing gaps improves accuracy For all methods, removing gap characters ... specific classification accuracy We used the Pfam -A dataset to carry out this comparison The families contained in the Pfam database vary in sequence count and sequence length We removed all families...
... to thank S Rama Rao, Vice President and General Manager of Hellosoft India Pvt Ltd and Dr Y Yoganandam, Senior Technical Director of Hellosoft India Pvt Ltd for their constant encouragement and ... domain sequence obtained from a frequency domain loading by a PN sequence (see (3)), its zero-lag autocorrelation magnitude is much larger than that of a nonzero lag The magnitude of lag-one autocorrelation, ... integer part m From (9) and (10), and assuming that variance of the error ( EURASIP Journal on Wireless Communications and Networking Table 1: Integer frequency offset estimate m, mean and standard...
... and spectral subtraction Singular value adaptation In the singular value adaptation (SVA) method [5], the p dominant singular values of Hx are mapped onto the original (clean) singular values of ... TDC and SDC estimators are applied [30] As a possible solution, Mittal and Phamdo [30] proposed to classify the noisy frames into speech-dominated frames and noise-dominated frames, andto apply ... be compared to spectral subtraction Evaluation database As test material we took the resource management (RM) database (available from LDC [34]) These data are considered as clean data, to which...
... points within a certain distance from the data point i A peak has the maximum magnitude inits local area, therefore, its local maximum is itself By identifying all data points whose local maximum ... point around each data point Assume there is a data set of N data points to be clustered The local maximum of a data point i is the data point whose magnitude is the maximum among all the data ... (clusters A2 and B2) The ALL samples fall into two classes: B-lineage ALL (clusters A1 1 and A2 1) and T-lineage ALL (clusters A1 2 and A2 2), some of which are taken from known sex patients (F for female...
... from Reactome and the four external databases were maintained ina database, which was also used to store PPI data (see below) We have also imported human transcription factor and target interactions ... imported data into the Reactome database, the original Reactome schema was extended by adding one new class, Interaction, as a subclass to Event, anda new attribute, dataSource, to the top-most class ... complexes annotated in pathways by defining a FI as an interaction in which two proteins are involved in the same reaction as input, catalyst, activator and/ or inhibitor, or as components ina complex...
... simulation based on kinetic equations requires a large variety of rate equations and kinetic parameters, and unfortunately, such data are rarely available as a complete set Recently, our laboratory ... monophosphate Inosine Potassium Lactate Nicotinamide adenine dinucleotide Nicotinamide adenine dinucleotide Nicotinamide adenine phosphate Nicotinamide adenine phosphate Sodium Phosphoenolpyruvate ... Lactate transport process Leak of Potassium Leak of Sodium Sodium/potassium pump Adenosine transport process AMP phosphohydrolase Adenosine deaminase Adenosine kinase Adenylate kinase Adenosine...
... chromatography The proteins were characterized and prepared for crystallization trials using biophysical methods A summary of a typical preparation for each clone, and the preparation and characterization ... including search functionality was developed, using the Java programming language Determination of reading frames The reading frame of a cDNA insert was determined using the following formula: ... resistance to 15 µg/ml kanamycin and carries the lacIQ repressor and the argU gene for the arginine tRNA that recognizes the rare codons AGG and AGA The low abundance of this tRNA is especially...
... Volume to Draining Angle 30 2.2.3 Cross-Contamination Study Using Rinsing Station 31 2.2.4 Development of the Alpha Prototype DropArrayTM Accelerator and Plates 32 2.2.5 AlamarBlue® Assay in DropArrayTM ... undergo Caspase activation at a doxorubicin dosage of > µg/ml Values are mean ± standard deviation; n = 75 Fig 4.1 (a) SP analysis of human cervical carcinoma Hela The missing characteristic tail in ... introduced in between different steps DropArrayTM plate Alpha Prototype of DropArrayTM Accelerator Fig 2.7 Alpha prototype of DropArrayTM plate and DropArrayTM Accelerator with user interface to input...
... used to express variable values at the control volume surface in terms of the nodal values Surface and volume integrals are approximated using suitable quadrature formulae As a result, one obtains ... volumes, and the conservation equations are applied to each control volume At the centroid of each control volume lies a computational node at which the variable values are to be calculated Interpolation ... obtains an algebraic equation for each control volume, in which a number of neighboring nodal values appear Since all terms that need be approximated in the FV method have physical meaning, it...