A content caching strategy for named data networking

... Hosseini Farahabadi, Mr Sasan Safaie, Mr Hooman Shams Borhan, Mr Amir Mortazavi, Dr Abbas Eslami Kiasari They always supported me in any circumstances I would also like to thank all my flat mates during ... these five years Dr Mojtaba Ranjbar, Dr Mohammadreza Keshtkaran, Mr Hassan Amini, Mr Mehdi Ranjbar, Dr Hossein Eslami, Mr Sai Sathyanarayan, for making our home warm and joyful and for your kind ... the available information about the content How to make sure that names are unique How to find a name for a particular content • Security - NDN secures each and all Data packets by cryptographically...

Lore: A Database Management System for Semistructured Data ppt

... no path expressions that not exist in the database In typical situations, the DataGuide is signi cantly smaller than the original database Figure shows a DataGuide for the sample OEM database ... unique path expressions As an example, Figure 10 is a screen snapshot of the Java presentation of a DataGuide This DataGuide summarizes an existing database for Stanford's Database Group, similar ... standard operators such as Scan and Join, some take an original avor For example, Scan may take as argument a general path expression, and therefore may entail complex searches in the database...

Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf

... Virology Journal 2008, 5:135 http://www.virologyj.com/content/5/1/135 (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A A T C ... CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC AACATTCAGGGAGCTAAATCCAG 200 nM 200 nM Actin2 ... GGTCGCTTCGACATARTCACG 200 nM 200 nM Sequencing of TYLCV cloned sequences pGreen1589 (+) pG1825(-) 579 (+) 1141 (+) 1741(+) 2321(+) CACGACGTTGTAAAACGACG CACAGGAAACAGCTATGACC GATGTTACTCGTGGATCTGG CATGATCAACTGCTCTGATTAC...

a universal execution engine for distributed data-ﬂow computing doc

... [2]—remains a popular platform for parallel iterative computations with large inputs For example, the Apache Mahout machine learning library uses Hadoop as its execution engine [3] Several of the Mahout ... languages have not demonstrated as great scalability as MapReduce or Dryad, which sacriﬁce expressivity for efﬁciency 7.3 Declarative programming The relational algebra, which comprises a relatively ... fault tolerance across multiple iterations, and neither can support Dryad-style task dependency graphs Finally, Piccolo is a new programming model for dataparallel programming that uses a partitioned...

Market analysis and developing a competitive marketing strategy for selling medical solid waste wastewater treatment equipment to customers in vietnam

... Solid Waste and Wastewater Treatment Products to Customers in Vietnam Markets The research aims to serve any sustainable medical waste treatment equipment manufacturers in the West who are interested ... Lahti University of Applied Sciences Master Programme in International Business Management BUI, THIEN TOAN Market Analysis and Developing a Competitive Marketing Strategy for Selling Medical Solid ... analyzing marketing opportunities, selecting target markets, designing marketing strategies, developing marketing programs and managing the marketing effort (Kotler, et al., 2009 p 12) When a...

Báo cáo khoa học: " A new therapeutic strategy for lung tissue injury induced by influenza with CR2 targeting complement inhibitior" ppt

... function, and can expand small vessels and improve permeability; C 3a, C 4a and C 5a have anaphylatoxin function, and can degranulate mast cells and basophils, release vasoactive mediators and induce ... inflammatory reaction; C 3a, C 5a Page of and C5b67 have chemotaxis function, and can attract inflammatory cells to concentrate and migrate toward the inflammatory region activated by the complement, ... this article as: Zhang et al.: A new therapeutic strategy for lung tissue injury induced by influenza with CR2 targeting complement inhibitior Virology Journal 2010 7:30 Submit your next manuscript...

Báo cáo sinh học: "Combined analysis of data from two granddaughter designs: A simple strategy for QTL conﬁrmation and increasing experimental power in dairy cattle" potx

... benefits of a combined analysis of data from different granddaughter designs QTL mapping / granddaughter design / combined analysis / QTL confirmation / dairy cattle INTRODUCTION With the aid of genetic ... traits and somatic cell score in order to conduct a QTL confirmation study and to increase the experimental power Data were exchanged in a coded and standardised form The combined data set (JOINT-design) ... show a significant effect in both data sets A second aim was a joint analysis of the two data sets in order to increase family size and, hence, statistical power to detect further QTL MATERIALS AND...

Báo cáo y học: "A strategy for extracting and analyzing large-scale quantitative epistatic interaction data" pptx

... highly likely to be a real synthetic interaction and sc approaches as an interaction is highly likely to be a real alleviating interaction - genes with correlated patterns and a synthetic interaction ... mutations both yield slow growth phenotypes (blue circles), both yield growth phenotypes typical of our set of mutant strains (green triangles), and both yield relatively fast growth phenotypes (red ... data analyses We expect that the tools presented here should be useful for analysis of E-MAP and SGA data, and with fairly straightforward modification, they could also be applied to large-scale...

Marketing Strategy for a Business Service Firm

... fundamental knowledge about strategy, marketing service strategy and the concept of effective marketing strategy This chapter aims to change the attitude of Vietnamese managers in the VFCFIs toward marketing, ... emphasis to a major function of management of organization Strategy and strategic management concepts help managers in the VFCFIs understand the important role of strategy in an organization Strategy ... Vietnam and international markets, acts as agent for patents and registration of trade and service marks and for protection industrial and intellectual property VIETCOCHAMBER is a very big organization...

Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

... Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular sludge Air was introduced from the bottom of the reactor, and aeration rate was gradually increased ... in a continuous-flow reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of aerobic granular sludge By setting and controlling adequate ... decided the control strategy for the selection of well-settling sludge Then, we applied the strategy to the formation of aerobic granular sludge in a continuous experiment In addition, the effect of...

A critical discourse analysis of president bush’s speech outlining strategy for victory in iraq

... B - - : 78 A # M * # ! B - A * * % 73 , ) $ %6 &&4 ) A # A # # B - A A B , -% 73 $ @ ) # A % &'') ! # ? # / ; 5 * * / * * + , - A / A A / / ( % ) , - # - / < # * # % ) # # # # $ A 26 * I+ ... * ) +D % # - ' A +D # # # # * # # * # ; # A 7< # %A # 4FF ) ;< ;< ;< * ;< < # J J ! H ;< # # # M M "* / , ;< * ! ;< A ; A : ) /< % # A # 5 "*" # * % # ) # - # /B - ! - & - A ! N # 7 # ? ... # * # A % ) % #) +D % - ) # A # B - B - 4F +D % - ) +D A +D D %+D) 6 # # # 6 + ; * # ' B %8 A 4FF &) **+ +D #0 D # - +D +D % ) * * B - +D A +D +D * # # 7 6 < +D +D 6 I < ' %8 A ! 60 A 4FF :C)...

Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

... for interaction proteomics Anal Chem 74, 4725–4733 Kagebayashi C, Yamaguchi I, Akinaga A, Kitano H, Yokoyama K, Satomura M, Kurosawa T, Watanabe M, Kawabata T, Chang W et al (2009) Automated ... Differential glycan profiling between cancer and normal cells enables identification of aberrant glycosylation in cancer [indicated as a red triangle in (B) and (C)] as an alteration in lectin signal pattern ... Nakaya S, Ito H, Sato T, Shikanai T, Takahashi Y, Takahashi K & Narimatsu H (2005) A strategy for identification of oligosaccharide structures using observational multistage mass spectral library...

Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx

... The Pathways Commission Charting a National Strategy for the Next Generation of Accountants A thank you is just not sufﬁcient reward for the effort the Pathways representatives have put forth ... full text of Chapters & are available at www.pathwayscommission.org The Pathways Commission on Accounting Higher Education: Charting a National Strategy for the Next Generation of Accountants Quick ... that can sustain future accounting educational change efforts Page 97 The Pathways Commission on Accounting Higher Education: Charting a National Strategy for the Next Generation of Accountants...

Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf

... Effects of hypoxia on HO-1 and HO-2 expression in human cell lines We initially analyzed the effects of hypoxia on the expression of HO-1 and HO-2 in human cell lines of Reduced expression of heme oxygenase-2 ... we have analyzed the effect of hypoxia on the expression levels of HO-1 and HO-2 in various types of human cell line, including erythroleukemia and hepatoma cells We have shown that hypoxia reduces ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...

Xem thêm

Từ khóa: part i a bug hunting strategy for c a one pass methodology for sensitive data disk wipes accounting for initial conditions with a dd estimator—applications for survey data of varying lengths modulating amyloid amp 946 levels by immunotherapy a potential therapeutic strategy for the prevention and treatment of alzheimer s disease a dna vaccine strategy for effective antibody induction to pathogen derived antigens a tipping point strategy for driving socio economic revitalization in detroit and southeast michigan a one step strategy for oxide ceramics planning a terminal services strategy for wingtip toys a systems engineering approach for implementing data fusion systems strategy for the statistical evaluation of a data set of related molecules a strategy for dynamic interpretation managing and sharing data a best practice guide for researchers a strategy for comparing alternative software development life cycle models pdf for a manager or employee information and data mean the same thing personal knowledge management a strategy for controlling information overload Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)