0

a strategy for dynamic interpretation

Báo cáo khoa học:

Báo cáo khoa học: "A Strategy for Dynamic Interpretation: a Fragment and an Implementation" pot

Báo cáo khoa học

... Idea of Dynamic Interpretation Recent developments in Natural Language semantics have witnessed a shift away from static represen- tation languages towards representation languages with a dynamic ... Netherlands Abstract The strategy for natural language interpre- tation presented in this paper implements the dynamics of context change by translat- ing natural language texts into a meaning ... boldface for the test program Rt~ tn and italics for the formula Rt t t~. We omit outermost parentheses as usual, and use T for a formula which is always true, I for a formula which is always...
  • 10
  • 365
  • 0
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt

Báo cáo khoa học

... the dynamic mammalian glycome. Proc Natl Acad Sci USA104, 11534–11539.14 Tateno H, Uchiyama N, Kuno A, Togayachi A, SatoT, Narimatsu H & Hirabayashi J (2007) A novel strat-egy for mammalian ... MS.AbbreviationsAAL, Aleuria aurantia lectin; AFP, a- fetoprotein; GGDB, GlycoGene Database; GlycoProtDB, GlycoProtein Database; GMDB, Glycan MassSpectral Database; HCC, hepatocellular carcinoma; HV, healthy ... of a human glyco-gene library and comprehensive functional analysis.Glycoconj J 21, 17–24.2 Kameyama A, Kikuchi N, Nakaya S, Ito H, Sato T,Shikanai T, Takahashi Y, Takahashi K & Narimatsu...
  • 11
  • 854
  • 0
Connect and Catalyse: A strategy for business innovation 2008-2011 pdf

Connect and Catalyse: A strategy for business innovation 2008-2011 pdf

Tài chính doanh nghiệp

... innovation and a magnet for innovative businesses, where technology is applied rapidly, effectively and sustainably to create wealth and enhance quality of life.Innovation takes many forms and has ... enables, celebrates and ultimately rewards talent and innovation – and that retains and attracts talented people. The market for talent is global. We have to compete in that market.  Strategy ... departments and agencies.Key application areasWe are developing strategies in a number of broad areas representing major societal challenges or associated with the challenge of maintaining...
  • 24
  • 393
  • 0
A Strategy for Cancer Control in Ireland - National Cancer Forum 2006 pdf

A Strategy for Cancer Control in Ireland - National Cancer Forum 2006 pdf

Sức khỏe giới tính

... appropriate stage in the management of theirdisease; an enhancement of the palliative care capacity of primary care; integrated care pathways andmultidisciplinary teams that incorporate palliative ... NationalCancer Strategy. B.2.1 Review of the current status of cancer careEvaluation of 1996 National Cancer Strategy An evaluation of the 1996 Strategy, including a broadly based consultation ... years.17 A Strategy for Cancer Control in IrelandB.1 EpidemiologyCancer is a major cause of mortality and morbidity in Ireland – it accounts for approximately 7,500 deathseach year, a quarter of all...
  • 68
  • 391
  • 0
E-Commerce and Consumer Goods A Strategy for Omnichannel Success doc

E-Commerce and Consumer Goods A Strategy for Omnichannel Success doc

Tiếp thị - Bán hàng

... KongMumbaiSeoulShanghaiTaipeiTokyoAustralia,New Zealand & Southeast AsiaBangkokBrisbaneCanberraJakartaKuala LumpurMelbourneSydneyEuropeAmsterdamBerlinCopenhagenDüsseldorfFrankfurtHelsinkiIstanbulLondonMadridMilanMoscowMunichParisRomeStockholmStuttgartViennaWarsawZurichMiddle ... digital marketing organizations. A dedicated team offers enhanced focus, a means of nurturing new talent, and greater transparency and accountability for decision making. This alternative ... LumpurMelbourneSydneyEuropeAmsterdamBerlinCopenhagenDüsseldorfFrankfurtHelsinkiIstanbulLondonMadridMilanMoscowMunichParisRomeStockholmStuttgartViennaWarsawZurichMiddle EastAbu DhabiBeirutCairoDohaDubaiRiyadhNorth AmericaAtlantaBostonChicagoClevelandDallasDCDetroitFlorham...
  • 16
  • 266
  • 0
Integrating Gender into the World Bank’s Work: A Strategy for Action potx

Integrating Gender into the World Bank’s Work: A Strategy for Action potx

Ngân hàng - Tín dụng

... THE STRATEGY 31THE STRATEGY 23Box 2.2 Good Practice Example: Integration ofGender Analysis into a World Bank CountryAssistance Strategy and Analytical Work A high-quality Country Gender Assessment ... mobilize additional multilateral and bilateral financing,and (ii) organize Consultative Group meetings for specificcountries. The Bank also promotes collaboration with inter-national, national, and ... development actions, andwho can act as focal points for coordinating efforts such as fundrais-ing, are needed to support gender mainstreaming. Such technicalspecialists are particularly important...
  • 92
  • 359
  • 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học

... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCCJH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCCJH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCCJH6.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCGTGGTCCCL. ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCCVK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCCVK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCCVK6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCCVL1.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCCVL 3a. link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACCVL4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCCVL5.link...
  • 11
  • 679
  • 0
Auditing for Social Change: A Strategy for Citizen Engagement in Public Sector Accountability docx

Auditing for Social Change: A Strategy for Citizen Engagement in Public Sector Accountability docx

Cao đẳng - Đại học

... processes.Taking HIV/AIDS programs as a case study, UNDESA has found that legislative auditors at national and sub-national levels, as well as internal auditors of ministries and institutions, have ... Auditing Manual, Office of the Auditor General of Canada, August 199058 Auditing for Social Change for accounting and for auditing being formulated. But here again most develop-ing countries are not ... to take innovative steps to expand the pool of personnel available to serve on the PAC• Special attendance allowances, rather than a special salary, should be con-sidered for PAC attendance•...
  • 220
  • 373
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "A FOUNDATION FOR SEMANTIC INTERPRETATION " pot

Báo cáo khoa học

... based on that of Marcus (1980). Unlike Marcus's parser, Paragram has two types of rule: base phrase structure rules and transformational rules. It is also able to parse un- grammatical ... then throw away any that don't make sense to the database. If'Our choice of Paragram was largely pragmatic~it w&s avL/l- • ble and does not represent &ny particular commitment ... transformational g~ammar s. based on message passing, with the goal of running syntax and semantics in parallel and providing seman- tic feedback to the parser. A ~moderator" trans- lates...
  • 10
  • 390
  • 0
ukraine's trade policy. a strategy for integration into global trade. washington, 2005

ukraine's trade policy. a strategy for integration into global trade. washington, 2005

Tổng hợp

... efficientand effective conformity assessment system. Standard compliance is an important elementof export diversification strategy. Standards serve as a catalyst for technical and adminis-trative change, ... percent).xvAbbreviations and AcronymsACP African, Caribbean, and Pacific countriesAMS Aggregate Measure of SupportCEE Central and Eastern EuropeCEEC Central and Eastern European countriesCED ... countries.The analysis suggests that the primary constraints to export expansion and diversifica-tion in Ukraine are internal, and relate to conventional domestic factors such as a weak pri-vate sector and...
  • 269
  • 281
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

Điện - Điện tử

... experimen-tal trials. JD also participated in the analysis of the resultsand preparation of the manuscript. AS participated in theexperimental trials, were responsible for the statisticalanalysis and ... expec-tations to motion sickness symptoms and gastric activity. JPsychosom Res 2004, 56:721-726.10. Sugita N, Yoshizawa M, Abe K, Tanaka A, Watanabe T, Chiba S,Yambe T, Nitta S: Evaluation of adaptation ... in a driving simulator that was inaccordance with the vestibular and visual informationperceived [22]. This visual-based artificial horizonreduced perceptual errors and also reduced balance...
  • 9
  • 609
  • 0
Dự án nông nghiệp

Dự án nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed (Milestone 7) " potx

Nông nghiệp

... compilation and analysis of available secondary data; • documentation of activities for the training manual; and • planning for future training activities for 2 CAP staff at UWA associated with ... hoped that arrangements will be able to be made for training of CAP staff at SARE as planned during July/August 2009. This training will focus on advanced analysis of the data, and finalisation ... month period and the period after has been heavy, particularly for the CAP team. Dr Donna Brennan has taken maternity leave from January to May 2009 inclusive. This will mean a delay in the...
  • 12
  • 529
  • 0
Báo cáo khoa học nông nghiệp

Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " docx

Báo cáo khoa học

... implementation date of 1st May 2007. Australian team planning meetings commenced at UWA on a regular basis from the second week of May, and joint planning by the Vietnamese and Australian teams for ... labors Data collected is suitable for the objectives of the research Quantitative description of the supply chain for animal feeds in Vietnam Secondary data are relevant and available ... 10Australian team. The Australian team met with the IPSARD/CAP team during August 2007 to discuss and investigate issues relevant to the training manual such as: • Tangible outcomes...
  • 19
  • 497
  • 1

Xem thêm