a dna vaccine strategy for effective antibody induction to pathogen derived antigens
Báo cáo sinh học: "Evaluation of the VP22 protein for enhancement of a DNA vaccine against anthrax" pptx
Ngày tải lên :
14/08/2014, 19:22
... (5' ACTCTAGCTAGCACGGCGCCAACCCGATCCAAGACA 3') and VP22 R8 (5' ATTGTCACGGTCTGGAACCGTAGGAGCAGCTGGACCTGGACCCTCGACGGGCCGTCTGGGGCGAGA 3') Additionally, the gene for PA63 was PCR amplified from pGPA using ... we evaluate the potential of VP22 to enhance DNA vaccines against anthrax The spore-forming bacterium Bacillus anthracis causes the disease anthrax The current UK-licensed vaccine is an alum-precipitated ... PF, Farchaus JW, Benner GE, Waag DM, Little SF, Anderson GWJ, Gibbs PH, Friedlander AM: Comparative efficacy of experimental anthrax vaccine candidates against inhalation anthrax in rhesus macaques...
- 9
- 331
- 0
Báo cáo sinh học: "Dietary restriction abrogates antibody production induced by a DNA vaccine encoding the mycobacterial 65 kDa heat shock protein" doc
Ngày tải lên :
14/08/2014, 19:22
... hours later by ELISA in culture supernatants using anti-IFN-γ and anti-IL-4 as capture antibodies Statistical analysis Results were expressed as the mean ± SD for each variable Statistical analysis ... μm each) were stained with haematoxylin and eosin (HE), analyzed in an optical microscope and the images acquired with a digital camera coupled to the microscope Plasmid DNA construction and ... dark cycle) and temperature (23 ± 2°C) After weaning, mice received a 10 day acclimation on a standard chow (Labina, São Paulo, SP, Brazil) This animal chow is considered adequate for mice and...
- 8
- 154
- 0
DNA-Templated Organic Synthesis: Natures Strategy for Controlling Chemical ReactivityApplied to Synthetic Molecules** doc
Ngày tải lên :
05/03/2014, 21:20
... constrained to arise from monomers that can sequence specifically hybridize to a DNA template, or that can be cleaved from adapter molecules (analogous to natural tRNAs) that hybridize to DNA Summary ... is a significant challenge This strategy might also be adapted to release a readily detected chromophore or fluorophore in response to a DNA or RNA analyte Mattes and Seitz used DNA- templated amine ... concentration of any single homocoupling-prone substrate DNA- Templated Polymerization DNA- and RNA-templated phosphodiester formation and amine acylation reactions are iterated in nature to www.angewandte.org...
- 23
- 860
- 0
Báo cáo khoa học: "A Metric-based Framework for Automatic Taxonomy Induction" potx
Ngày tải lên :
30/03/2014, 23:20
... interaction between features and relations, as well as that between features and term abstractness Related Work There has been a substantial amount of research on automatic taxonomy induction As ... 0.12 Table F1-measure for Features vs Abstractness: ODP/is -a WordNet For example, under artificial intelligence, ODP has neural networks, natural language and academic departments Clearly, academic ... Berland and Charniak (1999) used two meronym patterns to discover part-of relations, and also used statistical measures to rank and select the matching instances Girju et al (2003) took a similar...
- 9
- 339
- 0
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf
Ngày tải lên :
20/06/2014, 01:20
... http://www.virologyj.com/content/5/1/135 (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A A T C G T G G C G C C G AAG CGCCTTTTCCT original viral sequence ... h To eliminate high molecular weight plant DNA, the 1–6 kb DNA fraction containing all the viral DNA forms (vDNA) according to Southern blot assay, was purified from a 1% agarose gel (SV Wizard ... CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC AACATTCAGGGAGCTAAATCCAG 200 nM 200 nM Actin2...
- 10
- 396
- 0
Market analysis and developing a competitive marketing strategy for selling medical solid waste wastewater treatment equipment to customers in vietnam
Ngày tải lên :
23/07/2014, 03:36
... 143 ABBREVIATIONS ADB Asian Development Bank AIC Advanced International Joint Stock Company APEC Asia – Pacific Economic Cooperation ASEAN Association of Southeast Asian Nations ATM Automatic ... legal factors, economic factors, social – cultural factors, technological factors and natural environment These groups of factors contain forces that can have a heavy impact on players‘ strategic ... expanding the total market and market share defense strategies Meanwhile, the market-challenger is always involved in attack strategies such as frontal attack, flank attack, encirclement attack,...
- 254
- 590
- 2
Báo cáo khoa học: "Effects of DDA, CpG-ODN, and plasmid-encoded chicken IFN-γ on protective immunity by a DNA vaccine against IBDV in chickens" pps
Ngày tải lên :
07/08/2014, 18:21
... detavitcani rof ammag-norefretni nekcihc fo tceffe tnavujdA M arumakaN ,Y ozimokoY ,T atagaN ,M awakimaK ,R ammupanattuR ,K ihsayaboK ,K arahekaT 93 955-055 ,831 ,3002 la te hoR gnuJ aH 863 ... ,setarbetrev morf ton tub ,airetcab morf AND T aganukoT ,T akoataK ,O onaY ,E otomaruK ,S adamihS ,T otomamaY ,S otomamaY 74 898-698 ,51 ,7991 eniccaV noitazinummi citeneg no ammag-norefretni fo tceffe ... ,nosirapmoc elpitlum esiwriap a htiw tset knar sillaW -laksurK cirtemarap-non ehT )ASU ,etutitsnI SAS( 10.8 SAS egakcap lacitsitats eht gnisu demrofrep erew sesylana eht llA sisylana lacitsitatS...
- 8
- 273
- 0
Báo cáo y học: " Protection against H1N1 influenza challenge by a DNA vaccine expressing H3/H1 subtype hemagglutinin combined with MHC class IIrestricted epitopes" ppsx
Ngày tải lên :
11/08/2014, 21:21
... HA302~316 (B) Simulated conformation of H7 HA candidate epitopes HA165~181 HA182~196 HA255~269 (C) Simulated conformation of H9 HA candidate epitopes HA37~54 HA73~90 HA123~140 Analysis of cytokine ... referred to as the “multi-epitope” vaccine) The vaccine was evaluated for induction of humoral and cellular immune responses in a mice model as well as for the protective efficacy against lethal H1N1 ... other vaccine antigens to enhance immunogenicity The advantage of combination vaccines is that they can potentially provide broader coverage to protect against rapidly mutating viruses such as influenza...
- 13
- 288
- 0
Báo cáo y học: "Synthetic rabbit-human antibody conjugate as a control in immunoassays for immunoglobulin M specific to hepatitis E virus" ppsx
Ngày tải lên :
12/08/2014, 04:20
... control of analytical results in the medical laboratory Eur J Clin Chem Clin Biochem 1996, 34:983-999 13 Koshy A, Grover S, Hyams KC, Shabrawy MA, Pacsa A, al-Nakib B, Zaidi SA, al-Anezi AA, al-Mufti ... HT, Lu Q: An outbreak of enterically transmitted non -A, non-E viral hepatitis J Viral Hepat 1999, 6:59-64 Tanaka T, Takahashi M, Kusano E, Okamoto H: Development and evaluation of an efficient ... read and approved the final manuscript 16 17 Acknowledgements This work was supported by funds from National Center for Clinical Laboratories 18 Author Details National Center for Clinical Laboratories,...
- 5
- 311
- 0
Báo cáo khoa học: " A new therapeutic strategy for lung tissue injury induced by influenza with CR2 targeting complement inhibitior" ppt
Ngày tải lên :
12/08/2014, 04:21
... function, and can expand small vessels and improve permeability; C 3a, C 4a and C 5a have anaphylatoxin function, and can degranulate mast cells and basophils, release vasoactive mediators and induce ... induce inflammatory reaction; C 3a, C 5a Page of and C5b67 have chemotaxis function, and can attract inflammatory cells to concentrate and migrate toward the inflammatory region activated by the ... which may induce inflammation again, damage the lung, and finally result in fatal pneumonia and acute respiratory tract infection syndromes This indicates that influenza patients require both antiviral...
- 4
- 220
- 0
Báo cáo sinh học: " A DNA vaccine against tuberculosis based on the 65 kDa heat-shock protein differentially activates human macrophages and dendritic cells" pot
Ngày tải lên :
14/08/2014, 19:22
... cellular activation To study the capacity of the cells to uptake DNA, macrophages and DCs were stimulated with Alexa Fluor 488-labeled DNA vaccine for h Then, the cells were analysed by flow cytometry ... cytometry analyses (data not shown) Results Uptake of DNA vaccine by macrophages and DCs To determine whether human macrophages and DCs would be able to taken up naked DNA- HSP65, we stimulated ... We also thank Mrs Izaíra T Brandão and Mrs Ana P Masson for technical assistance This study was supported by grants from Fundação de Amparo Pesquisa Estado de São Paulo (FAPESP), Programa Nacional...
- 11
- 313
- 0
A content caching strategy for named data networking
Ngày tải lên :
09/09/2015, 08:17
... Hosseini Farahabadi, Mr Sasan Safaie, Mr Hooman Shams Borhan, Mr Amir Mortazavi, Dr Abbas Eslami Kiasari They always supported me in any circumstances I would also like to thank all my flat mates during ... these five years Dr Mojtaba Ranjbar, Dr Mohammadreza Keshtkaran, Mr Hassan Amini, Mr Mehdi Ranjbar, Dr Hossein Eslami, Mr Sai Sathyanarayan, for making our home warm and joyful and for your kind ... Dr Yuda Zhao, Mr Nimantha Baranasuriya, Mr Girisha Durrel De Silva, Mr Kartik Sankaran, Mr Mobashir Mohammad, Mr Sajad Maghare I have been unwavering in their personal and professional support...
- 194
- 334
- 0
Development of a MACS based strategy for isolating rare cell populations from animal tissue for transcription factor studies
Ngày tải lên :
11/09/2015, 09:59
... and survive cryopreservation better (Said, Agarwal et al 2006; Dirican, Ozgun et al 2008; Makker, Agarwal et al 2008) (Grunewald, Paasch et al 2001; Said, Grunewald et al 2005; Grunewald, Paasch ... epithelial cells from distal cells, MACS was applied, where proximal cells were isolated using an antibody against aminopeptidase M, and distal cells using an antibody against Tamm-Horsfall glycoproteins ... grow in a compacted fashion Examples of such malignancies are pancreatic carcinomas where the neoplastic cells make up widely separated malignant ducts amongst stromal cells, breast carcinomas with...
- 382
- 295
- 0
Báo cáo hóa học: " A Caccioppoli-type estimate for very weak solutions to obstacle problems with weight" potx
Ngày tải lên :
20/06/2014, 22:20
... so-called reverse Hölder inequality Gao and Tian [3] gave a local regularity result for weak solutions to obstacle problem in 2004 Recently, regularity theory for very weak solutions of the A- harmonic ... be a bounded regular domain in Rn, n ≥ By a regular domain, we understand any domain of finite measure for which the estimates for the Hodge decomposition in (2.1) and (2.2) are satisfied A Lipschitz ... Lipschitz domain, for example, is regular We consider the second-order degenerate elliptic equation (also called A- harmonic equation or Leray-Lions equation) divA(x, ∇u) = where A( x, ξ ) : assumptions...
- 7
- 376
- 0
Báo cáo hóa học: " Research Article A Predictive NoC Architecture for Vision Systems Dedicated to Image Analysis" potx
Ngày tải lên :
22/06/2014, 22:20
... the Harvard model, which has physically separate storage and signal pathways for instructions and data Our model is based on these separated flows: the input data flow is separated from the command ... most suitable NoC topology for a particular application and mapping of the application onto that topology There are many image processing algorithms, and their identifying characteristics may be ... Acquisition Storage Parameters Dynamic Dynamic Static Dynamic Dynamic Static Static Static Scheduling Dynamic Dynamic Static Dynamic Algorithm Static Static Dynamic Dynamic External device Asynchronous...
- 13
- 566
- 0
báo cáo khoa học: " Conjugated polymer nanoparticles for effective siRNA delivery to tobacco BY-2 protoplasts" potx
Ngày tải lên :
11/08/2014, 11:21
... 69.5,59.0 Preparation of siRNAs for cellulose synthases, NtCesA- 1a and NtCesA-1b TRIzol® reagent was used to extract total RNA from tobacco (N tabacum) leaves (Invitrogen Corp, Carlsbad, CA) cDNA of the ... nontoxic to BY-2 protoplasts Reports indicate that cadmium-based nanoparticles have the potential to be cytotoxic to mammalian cells The cytotoxic potential can be influenced by the particle sizes and ... (5’-AGTGTA TGTGGGTACCGGATG-3’) and NtCesA reverse (5’-CCATATGGGACAATGCCTAC-3’) primer that also shares homology with NtCesA2 Forward (5’-GCCTCCGTGGTGGTG CTAAG- 3’), and reverse (5’-TCAATCGGCACC...
- 14
- 295
- 0
Building the development strategy for the period 2007 to 2010 for Vietnam schréder Co., ltd
Ngày tải lên :
24/11/2014, 00:18
... and actions that managers take to achieve superior organizational performance A strategy allows an organization to be proactive rather than reactive in shaping its own future Social, political, ... External Factors Company opportunities and threats to company’s well-being Determine relevance of internal and external factors Identify and evaluate alternatives Craft the strategy Shared values and ... others fail? According to Hill and Jones (1998, 3), the strategies in an organization pursues have a major impact upon its performance relative to that of a competitor A strategy is a specific pattern...
- 145
- 491
- 0
Business strategy for greenwood corporationfrom 2012 to 2017
Ngày tải lên :
24/11/2014, 00:30
... being acquired 38 Table 6: Biggest MDF Manufacturers in South East Asia # Company Vanachai Metro Evergreen Dongwha Country Thailand Thailand Malaysia Malaysia Annual Capacity (CBM) 870,000 580,000 ... 2009 Regions/Country World South America North America Europe Asia China Asia except China India Thailand Malaysia Indonesia Vietnam Annual Capacity (m3) % of total 72,900,000 100% 6,300,000 8.6% ... chain theory), strategy formulation & strategic choice and strategy implementation All are reviewed as the basis for analysis in following chapters 7 Chapter Situation Analysis This chapter analyzes...
- 87
- 310
- 0
A suggestion on designing a final achievement test for general English 2 to non-English majors at Hanoi University of Industry
Ngày tải lên :
19/03/2015, 10:28
... such as formal and informal discussions with students and teachers as well as classroom test observation and critical reading Moreover, the study employs a combination of qualitative and quantitative ... that diagnostic test aims at identify the test-taker‟s strong and weak points in the language, as well as to attempt to explain why certain problems occur, and what treatment can be assigned to ... of a given language test task to the feature of a target language use (TLU) task.” Authenticity relates the test task to the domain of generalization to which we want our score interpretation to...
- 71
- 925
- 2
Recommending business strategy for pqc from 2012 to 2016
Ngày tải lên :
26/03/2015, 10:55
... premises and favorable location for banquet catering Standard sound, lighting systems and equipment Professional teams of cooks and managerial staff for high-quality banquet catering Standard and ... Center Organization of White Palace set an organization standard and enjoy the Wedding Party in fashionable style, international standard luxury A dramatic breakthrough in the advance hierarchy of ... source Number Name of tables % (estimated total Max/day) White Palace 240 21% Grand Palace 220 19% Gala Royal 200 18% Diamond Palace 200 18% Callary 150 13% and evaluation of Wedding and Convention...
- 82
- 607
- 0