modulating amyloid amp 946 levels by immunotherapy a potential therapeutic strategy for the prevention and treatment of alzheimer s disease
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... is initially present as a soluble, unaggregated species, and it is only through the processes of oligomerization, aggregation and fibrilization that Ab forms amyloid plaques As amyloid plaques ... availability for treating AD P J Crouch et al established, but the role for metal dyshomeostasis in all aspects is clear In the AD affected brain, metal dyshomeostasis is evident in the form of a substantial ... Ceruloplasmin is increased in cerebrospinal fluid in Alzheimer s disease but not Parkinson s disease Alzheimer Dis Assoc Disord 8, 190–197 Hye A, Lynham S, Thambisetty M, Causevic M, Campbell J, Byers...
- 9
- 634
- 0
Báo cáo y học: "The feasibility of axial and coronal combined imaging using multi-detector row computed tomography for the diagnosis and treatment of a primary spontaneous pneumothora" pps
... coronal imaging of ELCs increases the detection rate of ELCs The coronal images can be used to reassess ELCs in cases where the diagnosis of ELCs is difficult or vague on axial images, and for the ... bronchial trees Therefore cranio-caudal evaluation is necessary for accurate examination of ELCs HRCT is traditionally performed by axial imaging Although axial imaging has the advantage of the ... in the surgical field, the suspected area was resected The final confirmation of ELCs was based on the pathology reports Axial and coronal HRCT protocol Data analysis The imaging parameters were...
- 5
- 657
- 0
Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx
... Data-analysis Primary effects will be calculated using multilevel regression analysis, for somatic and DSC units separately The GDS-8-scores and CSDD-scores will be used in the primary analysis ... processes, standardized case report forms are used to assess time invested by nursing staff, psychologist, elderly care physician and recreational therapist Also, number of hospital admissions (number ... a health state classification system with five domains (mobility, self-care, usual activities, pain/discomfort and anxiety/depression) and a rating of ‘own general health’ by means of a visual...
- 7
- 484
- 0
Regulation of the TRIP BR1 proto oncoprotein a potential therapeutic target for human cutaneous and intracavitory proliferative lesions
... and intracavitary superficial mucosal lesions such as vulvar intraepithelial neoplasia, cervical dysplasia or carcinoma in situ, oral cancer and nasopharyngeal bladder cavity mucosal surfaces, ... chemotherapeutic strategy for the treatment of cancers and other hyperplastic lesions such as psoriasis Appropriate targets for such novel peptide-based therapy are envisioned to include cutaneous ... Medicine of National University of Singapore, especially Prof Bay Boon Huat, Ms Stacy Tan, Ms Geetha Sreedhara Warrier and Ms Malika Raguraman for their kind helps during the last four years in NUS...
- 180
- 363
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... (18–23 ) These outbreaks were characterized by the transmission of M tuberculosis strains resistant to isoniazid and, in most cases, rifampin; several strains also were resistant to other drugs (e.g., ... HIV They also should be informed concerning a) the lack of data regarding the efficacy of preventive therapy for M tuberculosis infections caused by strains resistant to isoniazid and rifampin and ... teenage years, increased sharply with age for both sexes and all races Cases of TB among children
- 27
- 1,309
- 3
báo cáo hóa học: " Inflammatory cytokine levels correlate with amyloid load in transgenic mouse models of Alzheimer''''s disease" potx
... manufacturers protocol Statistical analyses For statistical analyses, ANOVA and t-tests were performed where appropriate using SPSS for Windows release 10.1 Hierarchical cluster analysis of A -cytokine ... performed the Bio-plex assay, ELISAs and drafted the manuscript DP conceived the design of the study, carried out Bio-plex assays, performed statistical analyses and aided in manuscript preparation ... There are numerous reports of increased levels of cytokines in the brains of Alzheimer' s disease patients, and in transgenic mouse models of Alzheimer' s disease [10-12] However, all these reports...
- 10
- 689
- 0
Báo cáo khoa học: " A new therapeutic strategy for lung tissue injury induced by influenza with CR2 targeting complement inhibitior" ppt
... function, and can degranulate mast cells and basophils, release vasoactive mediators and induce inflammatory reaction; C 3a, C 5a Page of and C5b67 have chemotaxis function, and can attract inflammatory ... syndromes This indicates that influenza patients require both antiviral drugs and immunosuppression drugs [10] Studies have shown that inflammatory injury of lung tissues is the main fatal reason for ... activation can produce inflammatory media including C 2a, C 3a, C 4a and C 5a C 2a has kinin-like function, and can expand small vessels and improve permeability; C 3a, C 4a and C 5a have anaphylatoxin function,...
- 4
- 220
- 0
a systemic funtional perspective on the meaning and structure of the story the selfish giant by oscar wilde = bình diện ngữ pháp chức năng hệ thống về cấu trúc và ngữ nghĩa của truyện ngắn gã khổng lồ ích kỷ
... processes of consciousness and physiological states” (Halliday, 1994:107) Behavioural processes are the least salient of Halliday s six process types, and the boundaries of behavioural processes are ... 'Proposition' stands for the exchange of information in which case language is the end as well as the means, and the answer is always a verbal one As stated by Halliday, propositions can be affirmed ... Process types, Category meaning, and key participants Table B: The main types of circumstances and their features Table C: Themes and features Table 1: Clause and Clause Complexes Analysis Table...
- 137
- 1,065
- 4
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
... has the following typical features : - The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is ... transformation can be defined We propose therefore in this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the ... currents andifluxes due to the permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation,...
- 8
- 517
- 1
Báo cáo khoa học: Implication of calpain in neuronal apoptosis A possible regulation of Alzheimer’s disease doc
... Although calpains may enhance caspase activity, they can also function to block the activation of caspases For example, calpains can cleave caspase rendering it incapable of activating caspase and ... that has been implicated in neuronal cell death [7] (Fig 1) Cross-talk between calpains and caspases The striking similarity between the substrates for caspases and calpains raises the possibility ... suggested a possible cascade of events involving three protease systems: calpain-induced cathepsin release, cathepsin-mediated caspase activation and caspase-mediated calpastatin degradation leading...
- 7
- 341
- 0
Báo cáo khoa học: "A GENERATIVE GRAMMAR APPROACH FOR THE MORPHOLOGIC AND MORPHOSYNTACTIC ANALYSIS OF ITALIAN" ppt
... stem (the invariable part of the lemma): this is the access key in the table the third is the name of the "class of endings" associated with every lemma A class of endings is the set of all the ... the past participle The form is passive, as "chiamare" (to call) is a transitive verb (the auxiliary verb for the active form is to have) In 36 this case morphosyntactic analysis has solved an ... structured as tables of a relational data base l the morphologic and semantic characteristics of the word, but not its syntactic cathegory: for example, the easa (house) can be altered in casina (little...
- 6
- 378
- 0
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... Bioscience, San Jose, CA, USA) The concentration of the purified protein was determined by quantification of the intensity for the separated bands in SDS ⁄ PAGE analysis using imaging software ... TGase in principle, because cadaverine is an amine substrate known to react with any active TGase Although aberrant TGase activity has been reported in several skin diseases, as a consequence of ... In a series of studies, 12-mer sequences acting as isozyme-specific substrates for Factor XIII, TGase and TGase were obtained From these studies, we selected the most reactive and isozyme-specific...
- 11
- 645
- 0
Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc
... apoptosis on FLS, we conducted a caspase activity assay MK-4 activated caspase assay in a dose-dependent manner (Fig 2C) By contrast, vitamin K1 did not show any effects on caspase activity and ... measurement was performed in triplicate and the results are presented as the absorbance (A2 70 nm) compared with positive (TNF -a) and negative (NaCl ⁄ Pi) controls Synovial fibroblasts Caspase ⁄ assay Synovial ... USA) Apoptosis was determined using the Caspase-Glo ⁄ assay kit (Promega Co., WI, USA) to detect caspase ⁄ activity Each measurement was performed in triplicate and the results are presented as...
- 7
- 455
- 0
Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot
... polymerization of wild-type and Ser49Pro neuroserpin, respectively, prompted an assessment of the effect of alcohols and sugars on the Z variant of a1 -antitrypsin that also causes disease by polymerization ... The molecular pathology that underlies this conformational transition is now well defined and has been used as a paradigm for other diseases that result from aberrant b-strand linkage and tissue ... [20] The formation of polymers also underlies diseases associated with point mutations of other members of the serpin superfamily a1 -Antitrypsin is secreted from the liver and is the most abundant...
- 13
- 494
- 0
Updates in the Diagnosis and Treatment of Vasculitis Edited by Lazaros I. Sakkas and Christina Katsiari pptx
... vessels [2] ANCA- associated Systemic Vasculitis (AASV) is the most common primary systemic smallvessel vasculitis that occurs in adults AASV is a small-vessel vasculitis affecting arterioles, ... diuretics, and many others PAN= Polyarteritis Nodosa RA= Rheumatoid Arthritis SLE= Systemic Lupus Erythematosus Table Classification of systemic vasculitis ANCA-associated systemic vasculitis (AASV) ... underlying AASV may help in the search for better treatment modalities for this serious and devastating illness Pathophysiology of ANCA-Associated Systemic Vasculitis (AASV) The pathophysiology of AASV...
- 282
- 648
- 0
Báo cáo hóa học: " Targeting the inflammation in HCV-associated hepatocellular carcinoma: a role in the prevention and treatment" pptx
... diethylnitrosamine (DEN)inducedHCC) in rats Gallic acid treatment significantly attenuated some alterations (i.e increased levels of aspartate transaminase, alanine transaminase, alkaline phosphatase, acid ... recurrence rate can be as high as 50%[1] Although liver transplantation has been successful for the treatment of early-stage liver cancer, a small number of HCC patients qualifies for transplantation ... Oxidative stress occurs when the generation of free radicals and active intermediates in a system exceeds the system s ability to neutralize and eliminate them In these conditions, ROS and RNS affect...
- 11
- 649
- 0
Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc
... DNA PS DNA PS DNA Phase II Phase II Phase II EPI-2010 Asthma PS DNA Phase II GTI 2040 EpiGenesis Pharmaceuticals Lorus Therapeutics Cancer PS DNA Phase II ISIS 104838 Avi4126 ISIS AVI BioPharma ... Acknowledgements The authors wish to thank Kosi Gramatikoff for graphic assistance and helpful discussions They are grateful to Libby Weber for the critical assistance on the completion of this manuscript ... Clinical trials and an approved therapy based on AS-ON technologies [31-33] Product Company Target Disease Chemistry Status Vitravene (Fomivirsen) Affinitac (ISIS 3521) Genasense Alicaforsen (ISIS...
- 6
- 568
- 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... DFASA-GDTD1B DFASA-GDTD1B AAC59452 (58aa) AAG21352 (58aa) AAG21351 (59aa) AAG10783 (58aa) AAD56945 (59aa) AAC55644 (55aa) AAC59454 (156aa) AAC55645 (55aa) CAB61753 (151aa) CAB61754 (151aa) AAC55648 ... (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B QAHNA-GDTD1B AAF81664 (158aa) ... GTGTTCGACTTTGCCAGCCTGTACCCCAGCATCATCCAGGCCCACAACCTGTGC GTATTGGATTTTGCAAGTTTATATCCAAGTATAATTCAGGCCCATAACTTATGT GTGTTTGATTTTCAAAGTTTGTATCCGAGCATTATGATGGCGCATAATCTGTGT GTGTTCGACTTTGCCAGCCTCTACCCTTCCATCATCATGGCCCACAACCTCTGC...
- 24
- 604
- 0
báo cáo hóa học: " Novel Aβ peptide immunogens modulate plaque pathology and inflammation in a murine model of Alzheimer''''s disease" potx
... analysis, data analysis and manuscript preparation; IH performed immunohistochemistry, image analysis, data analysis and presentation and assisted with perfusions and animal care; OY performed ... immunohistochemistry and image analysis; DC assisted with the design of the study and manuscript preparation; CG contributed to the design of the study and data analysis, and manuscript preparation AJT ... per age per marker as noted in legends and text Quantitative comparisons were performed on sections processed at the same time Single ANOVA statistical analysis was used to assess the significance...
- 19
- 483
- 0
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... insertion stages and canal and reinserting the prosthesis The FRF had a normal evolution during the reinsertion and the graphs corresponding to the final two stages, labelled as stage 4a and stage 5a, ... dynamic analysis [29] the successive steps in the insertion process were simulated in terms of contact areas and interface stresses, and the vibration response in each step was calculated by finite ... the insertion, when the resistance against the stem displacement increases, the shapes of the successive graphs are very similar and the shift is less important When the FRF graph does not change...
- 10
- 542
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25