poly i c induces a marked inflammatory response in the lungs of mice

Báo cáo y học: " Lymphocyte apoptosis in murine Pneumocystis pneumonia Xin Shi, Nicole J LeCapitaine, Xiaowen L Rudner, Sanbao " potx

... 5'-TTACCGCGAGGCTGAAGACCACCC-3'; mSurvivin, 5'-ATCGCCACCTTCAAGAACTGG-3', 5'TCAGGCTCGTTCTCGGTAGG-3', 5'-ATGAAGCCAGCCT CCGCCATTCGC-3'; 18s rRNA, 5'-ATTCGAACGTCTGCCCTATCA-3', 5'-GTCACCCGTGGTCACCATG-3', ... primer, and prober): mBcl-2, 5'-TGGGATGCCTTTGTGGAACTAT3'; 5'-AGAGACAGCCAGGAGAAATCAAAC-3', 5'TGGCCCCAGCATGCGACCTC-3'; mBim, 5'-AAACTTACACAAGGAGGGTGTTTG-3', 5'-AATGCCTTCTCCATACCAGACG-3', 5'-TTACCGCGAGGCTGAAGACCACCC-3'; ... following inoculation of Pneumocystis Apoptosis of lavage lymphocytes was assayed by flow cytometry as surface staining of annexin V and intracellular activity of caspases 3, 8, and In control mice, ...

15
267
0

Báo cáo khoa học: "Density of CD4(+) and CD8(+) T lymphocytes in biopsy samples can be a predictor of pathological response to chemoradiotherapy (CRT) for rectal cancer" ppt

Danh mục: Báo cáo khoa học

... embedded in paraffin, stained with hematoxylin-eosin, and the grade of tumor response was evaluated by pathologists according to the definitions in the Japanese Classification of Colorectal Carcinoma ... in other tumors [16,22,23] Since anal carcinoma is usually associated with human papilloma virus, specific viral proteins processed in tumor cells may critically affect the histological characteristics ... Ministry of Health, Labor and Welfare of Japan Authors’ contributions JK participated in the study design and data retrieval and analysis KY, KK, ES participated in immunostaining and data analysis...

6
371
0

Báo cáo hóa học: " Decreased level of recent thymic emigrants in CD4+ and CD8+T cells from CML patients" pdf

Danh mục: Hóa học - Dầu khí

... prominent decrease of sjTRECs levels in CML, indicating the reduction of recent thymic emigrants affects the majority of TRBV subfamilies Page of Competing interests The authors declare that they ... date there are only a few papers describing TRECs level in hematopoietic malignancies [16,17] The exact value of sjTRECs level in PBMCs from CML patients are influenced by contaminating normal ... sjTRECsexpressing CD4+ and CD8+ T cells were significantly decreased in CML patients, as compared with age and sex Li et al Journal of Translational Medicine 2010, 8:47 http://www.translational-medicine.com/content/8/1/47...

8
367
0

Báo cáo y học: "Heterogeneity of CD4+ and CD8+ memory T cells in localized and generalized Wegener’s granulomatosis." potx

Danh mục: Báo cáo khoa học

... to chemotactic gradients, cytokine release and cytotoxic activity of distinct T cell populations Detection of the inducible inflammatory chemokine receptors CCR5 and CCR3 on CD45RA+ T cells suggests ... formation of granulomatous lesions and vasculitis in WG Because chemokine receptors such as the inducible inflammatory chemokine receptors CCR5 and CCR3 – along with selectins and adhesion molecules ... depletion of CCR5+ and CCR3+ T cells owing to enhanced recruitment into inflammatory sites Downregulation of the cell-surface expression of the inducible inflammatory chemokine receptors CCR5 and CCR3...

7
354
0

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

Danh mục: Báo cáo khoa học

... in children younger than years old: normal values in a population at risk for human immunodeficiency virus infection and diagnostic and prognostic application to infected children Pediatr Infect ... band is equal to that of the competitor's upon co-amplification Staining with ethidium bromide can be quantitative provided that digital imaging is employed [9] The standard curve plots the log cDNA/competitor ... were chosen that span introns of CD4 and CD8 genes in order to avoid amplification of cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional mutants are constructed...

4
319
0

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Danh mục: Báo cáo khoa học

... B chain C1 QBL ggcctcacaggacaccag C1 QBR ccatgggatcttcatcatcata VIRvsLTNP CD4 6.1 6.0 C1 QC NM_172369.3 complement component 1, q subcomponent, C chain C1 QCL aaggatgggtacgacggact C1 QCR ttctgccctttgggtcct ... therapeutic interventions aiming at preserving mitochondrial function could be clinically beneficial Building up database of the pathway interactions will definitely aid the understanding of the interconnections ... (zidovudine, lamivudine, stavudine, emtricitabine, tenofovir) in association with one or two protease inhibitors (darunavir, ritonavir, indinavir, saquinavir, atazanavir) Eleven patients came...

21
376
0

Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt

Danh mục: Báo cáo khoa học

... the clinical management of HIV-infected individuals to monitor the severity of immunodeficiency caused by HIV, and this acts as a basis for commencing HAART and prophylaxis for Pneumocystis carinii ... analysis because of individual variability in antigen expression significantly increased expression For HIV-specific CD8+ cells, diminished proliferative capacity results in a memory T cell population ... membranes via specific associations with each other and distinct integrins A recent study has shown that the tetraspanin-enriched microdomains on the cell membrane can function as gateways for HIV egress...

13
289
0

Báo cáo y học: "Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells" pot

Danh mục: Báo cáo khoa học

... (Clontech), and inserted into pCHIX, a modified version of the pCSI vector that includes a C- terminal factor Xa cleavage site, and the hemagglutinin (HA) and histidine tags [1] After an overnight ... raised against a peptide encoding the 13 C- terminal amino acids As expected from the literature cited above, Glut-1 expression was significantly increased in both CD4 and CD8 T cells following ... mAb1418 following permeabilization but did not detect any significant changes as compared to the extracellular binding profile This was also concerning as two populations of positivebinding cells were...

9
283
0

Báo cáo y học: " Interaction between human lung fibroblasts and T-lymphocytes prevents activation of CD4+ cells" pdf

Danh mục: Báo cáo khoa học

... Several data indicate that in pulmonary chronic inflammatory diseases, such as bronchial asthma and interstitial lung diseases, lymphocytes are in an immunologically activated state likely as the ... 5'-GAGCTGTTTGAGAACACCTC-3' and antisense 5'-TCACACTTCACTGTCACCTC-3' giving a 367 bp PCR product; COX-2 sense 5'TTCAAATGAGATTGTGGGAAAATTGCT-3' and antisense 5'-AGATCATCTCTGCCTGAGTATCTT-3' (305 bp product); LFA-1 ... revealed increased ICAM-1 and COX-2 transcripts in fibroblasts incubated with activated lymphocytes for 36 h (Fig 2a, b) Again, the increased expression was maintained in the presence of a separating...

13
278
0

Xác định sơ bộ giá trị phần trăm, tuyệt đối của tiêu chuẩn quần thể Lympho (T CD3, T CD4, T CD8, B, NK) ở nhóm người bình thường tại thành phố Hồ Chí Minh bằng máy Fascalibur docx

Danh mục: Báo cáo khoa học

... Shahpour Shahghasempour, Mitra Gerami, Zinat Entezami Archives of Iranian Medecine, 2001; 4(2): 80-83 Age and sex related changes in lymphocyte subpopulation of healthy Asian subjects from birth ... This reference ranges is used like target values for the patients at Pasteur Institute-HCMC and then compare the results with those obtained in a group of healthy adults Iranian population The ... Mark J.Jaroszeski, Richard Heller Humana Press Practical flow cytometry Howard M Shapiro, M.D.Wiley Liss.1995 Enumeration of peripheral blood lymphocyte subsets in a healthy iranian population...

6
978
0

Báo cáo khoa học: Identiﬁcation of CD4 and transferrin receptor antibodies by CXCR4 antibody-guided Pathﬁnder selection pot

Danh mục: Báo cáo khoa học

... (human T-cell line), CEMX174 (hybrid human B-cell-T-cell line) and HeLa (human cervical carcinoma) All of the above cell lines were maintained according to the supplier’s recommendations Primary ... models of CXCR4 and CCR5 are available, modeling of appropriate conformational spaces of the N-terminus and extracellular regions is still challenging in the 3D structural modeling of G-protein-coupled ... parent cells, and this contributed to the intitial misidentiﬁcation of the two scFvs as antiCXCR4 It is noteworthy that radiolabeled immunoprecipitation with scFvs using anti-His–agarose beads is a...

10
473
0

Báo cáo hóa học: "Quantification of newly produced B and T lymphocytes in untreated chronic lymphocytic leukemia patients" ppt

Danh mục: Hóa học - Dầu khí

... obtained by PCR amplification of signal joints, which are sequences contained into KRECs, and the cycle threshold number obtained after amplification of coding joints, which are sequences generated ... the most precocious Analysis of tumor DNA interference in KRECs and TRECs quantification Statistical analysis Since data did not follow a Gaussian distribution, they were described in terms of ... Civili, Piazzale Spedali Civili 1, 25123, Brescia, Italy 2Laboratory of Biotechnology, Diagnostic Department, Spedali Civili, Piazzale Spedali Civili 1, 25123, Brescia, Italy Authors’ contributions...

7
559
0

Báo cáo y học: "Impact of cytokines and T lymphocytes upon osteoclast differentiation and function" pot

Danh mục: Báo cáo khoa học

... osteoblast differentiation, and its central role in regulating bone mass is exemplified by individuals with high bone mass phenotypes having activating mutations in the Wnt pathway Wnt signalling is also ... survival The importance of IL-17 and IL-23 in rheumatoid arthritis and other inflammatory diseases has been highlighted in studies using knockout mice IL-17 or IL-23 deficient mice were resistant ... contrast, IL-12 predominantly increases the production of IFN-γ, which is the principal osteoclast inhibitor in response to IL-12 treatment IL-12 and IL-18 act synergistically upon T lymphocytes to inhibit...

3
272
0

Báo cáo khoa học:" Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pptx

Danh mục: Cao đẳng - Đại học

... vaginal simian/ human immunodeficiency virus infection in macaques[27], HSV-2 infection in mice[ 28], gonorrhea in mice[ 29] In recent clinical trials sponsored by NIAID (The HPTN 035 Study of ... GGCTAACTAGGGAACCCACTGCTT 3'; reverse, 5' CCGAGTCCTGCGTCGAGAGAGC 3') and conditions (35 cycles with annealing temperature of 59 C) Equivalent dilutions of genomic DNA from CCRT K4 infected and ... 5' AAAGAACAATACTCAATTTCATTTGG 3') using as reaction conditions 58 C for annealing and minutes for extension time during 35 cycles Competing interests The authors declare that they have no competing...

9
329
0

Báo cáo khoa học: " Expression of Human CD4 and chemokine receptors in cotton rat cells confers permissiveness for productive HIV infection" pdf

Danh mục: Báo cáo khoa học

... vaginal simian/ human immunodeficiency virus infection in macaques[27], HSV-2 infection in mice[ 28], gonorrhea in mice[ 29] In recent clinical trials sponsored by NIAID (The HPTN 035 Study of ... GGCTAACTAGGGAACCCACTGCTT 3'; reverse, 5' CCGAGTCCTGCGTCGAGAGAGC 3') and conditions (35 cycles with annealing temperature of 59 C) Equivalent dilutions of genomic DNA from CCRT K4 infected and ... 5' AAAGAACAATACTCAATTTCATTTGG 3') using as reaction conditions 58 C for annealing and minutes for extension time during 35 cycles Competing interests The authors declare that they have no competing...

9
251
0

Báo cáo sinh học: " Streamlined design of a self-inactivating feline immunodeficiency virus vector for transducing ex vivo dendritic cells and T lymphocytes" ppsx

Danh mục: Báo cáo khoa học

... Matteucci D, Pistello M, Mazzetti P, Giannecchini S, Isola P, Merico A, Zaccaro L, Rizzuti A, Bendinelli M: AIDS vaccination studies using feline immunodeficiency virus as a model: immunisation with ... tropism With the aim to obtain a vector that could be used in mouse models, efficiency at transducing the murine cell line NIH-3T3 was a major guiding criterion in its design as well as in optimizing ... WPRE increases LA34 transduction efficiency for NIH-3T3 Because the findings above were indicative of a preferential ability of LA34 to transduce feline CrFK cells relative to the non feline cells...

13
277
0

Báo cáo khoa học: " Early changes of CD4-positive lymphocytes and NK cells in patients with severe Gram-negative sepsis" ppt

Danh mục: Báo cáo khoa học

... changes taking place in the clinical setting of a septic host is of prime importance in order to understand the underlying pathogenesis The majority of clinical studies not provide evidence about ... occurrence of CD4-lymphopenia in severe sepsis The applied flow cytometric analysis of apoptosis did not use propidium iodine staining positive for necrotic cells Application of the analysis was difficult ... lipopolysaccharide -induces lethal shock in mice J Immunol 2002, 169:1426-1432 Bouchon A, Facchetti F, Welgand MA, Colonna M: TREM-1 amplifies inflammation and is a crucial mediator of septic...

7
223
0

Báo cáo y học: "Determinants in HIV-1 Nef for enhancement of virus replication and depletion of CD4+ T lymphocytes in human lymphoid tissue ex vivo" doc

Danh mục: Báo cáo khoa học

... lack protein interaction motifs for the phosphofurin acidic cluster sorting protein (PACS) sorting adaptor (E 4A4 ) or SH3 domains (AxxA), and are deficient in modulating MHC class I cell surface ... FITC (Beckman Coulter, Fullerton, CA) 20 at RT Statistical analysis Analysis of HLAC infections was carried out in independent quadruplicate infections for each time point investigated Mean values ... motif and the interaction site for the NAKC signalosome as two distinct protein interaction sites involved in this process Individual mutation of both motifs significantly impaired Nef-mediated CD4+...

14
264
0

Báo cáo y học: " Effect of chloroquine on reducing HIV-1 replication in vitro and the DC-SIGN mediated transfer of virus to CD4+ T-lymphocytes" pdf

Danh mục: Báo cáo khoa học

... being considered as statistically significant Abbreviations Ab, antibody; CQ, chloroquine; DC, dendritic cell; DCSIGN, DC-pecific ICAM3 grabbing non-intergrin; ECD, extra-cellular domain; HCQ, ... 76:12855-12865 Hu J, Gardner MB, Miller CJ: Simian immunodeficiency virus rapidly penetrates the cervicovaginal mucosa after intravaginal inoculation and infects intraepithelial dendritic cells J Virol 2000, ... experimental variation and reflects the poor infectivity of the viruses from that time-point However, the main finding is that CQ did not diminish the replication capacity of HIV-1 TCID50/ml values...

12
316
0

Báo cáo y học: " Decrease of CD4-lymphocytes and apoptosis of CD14-monocytes are characteristic alterations in sepsis caused by ventilator-associated pneumonia: results from an observational study" ppt

Danh mục: Báo cáo khoa học

... Gram-negative microorganisms in the absence of any well-defined focus of infection, including intravascular-access devices [15] Criteria required for the diagnosis of CAP and HAP included the presence ... 10:146-154 The ACCP/SCCM Consensus Conference Committee, American College of Chest Physicians/Society of Critical Care Medicine: Definitions for sepsis and organ failure and guidelines for the use of innovative ... Martin-Loeches M, Armaganidis A, Rello J: Spectrum of practice in the diagnosis of nosocomial pneumonia in patients requiring mechanical ventilation in European intensive care units Crit Care Med...

8
343
0