sirna attenuated the poly i c induced growth inhibition and apoptosis in sk n as cells
Báo cáo y học: " Functional cooperation of of IL-1b and RGS4 in the brachial plexus avulsion mediated brain reorganizatio" pps
... G-protein coupled receptor 56, FK506 binding protein, N- ras protein, phospholipids D, cytoskeleton associated protein, dynactin, forming binding protein, serine peptidase inhibitor, tenascin, low ... G-protein signaling, the emerging picture of G protein signaling (RGS) proteins reveals a highly diverse, multifunctional signaling network, which could permit fine-tuning of its interaction with cytokines ... blotting The localization of PKCb within lipid rafts microdomain was assayed by discontinuous sucrose centrifugation and Western blotting (C) IL-6 content in the presence or absence of IL-1b, IL-1ra...
- 11
- 299
- 0
Báo cáo y học: " Quantitative biomarker analysis of synovial gene expression by real-time PCR" potx
... patients originally relied on protein analysis of fluid compartments Blood sampling is often included in clinical trials, and measurement of certain plasma constituents, such as C- reactive protein, ... determining the kinetics of saturation Significant improvements in quantification have been achieved through the elegant use of computerbased image analysis, and IHC changes can correlate with clinical ... method for measuring biomarkers in the synovium is IHC Selective expression of various proteins can be evaluated using IHC in specific regions such as the synovial lining, lymphoid aggregates,...
- 9
- 557
- 0
Báo cáo khoa học: "Comparative evaluation of phenobarbital-induced CYP3A and CYP2H1 gene expression by quantitative RT-PCR in Bantam, Bantamized White Leghorn and White Leghorn chicks" ppsx
... esaercni ot deunitnoc 73A3PYC fo level tpircsnart eht dna 73A3PYC ni derrucco noitcudni ,enil llec amotapeh nekcihc eht nI ]8[ noitartnecnoc Mµ 05 ta kaew saw nicipmafir dna tnetop ssel era NCP dna ... 1A3PYC( tar ,)5 4C2 PYC dna A3PYC ,2/1H2PYC( nekcihc ni seneg PYC fo rebmun no noitpircsnart eht sesaercni tnemtaert BP ]3[ sdnuopmoc suonegodne dna suonegoxe fo yticinegonicrac dna yticixot ,noitcaretni ... loisyhP J naC sdnuopmoc cinegoniryhprop fo noitartsinimda ovo ni eht gniwollof noitavitcani dna edimihtetulg dna ,latibrabonehp ,enosahtemaxed yb noitcudni :snoitalyxordyh diorets lamosorcim revil oyrbme...
- 7
- 291
- 0
Báo cáo sinh học: " Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" potx
... transmission The effectiveness of such interventions demands rapid, efficient, reliable and type specific assays These assays can serve as biological endpoints in deciding when to administer intervention, ... of the QiaAmp Mini kit extraction method and retested in the qPCR and inhibition assays HSV amplicon sequence confirmation of probe typing One in ten dilutions of the amplified positive products ... recorded This was conducted by questionnaire and an examination for genital lesion by the clinician/nursing officer The study was approved and Detection of HSV DNA, probe typing & melting point...
- 10
- 458
- 0
báo cáo hóa học:" Detection, quantification and genotyping of Herpes Simplex Virus in cervicovaginal secretions by real-time PCR: a cross sectional survey" pdf
... transmission The effectiveness of such interventions demands rapid, efficient, reliable and type specific assays These assays can serve as biological endpoints in deciding when to administer intervention, ... of the QiaAmp Mini kit extraction method and retested in the qPCR and inhibition assays HSV amplicon sequence confirmation of probe typing One in ten dilutions of the amplified positive products ... recorded This was conducted by questionnaire and an examination for genital lesion by the clinician/nursing officer The study was approved and Detection of HSV DNA, probe typing & melting point...
- 10
- 440
- 0
Báo cáo y học: " Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR" pot
... vaccine, particularly in vulnerable patients and will be instrumental in investigating HPV epidemiology in longitudinally collected samples Increasing oncogenic HPV viral loads have been associated ... oncogenic HPV infection in oral cancers of smoker/drinkers and high rates of infection in oral cancers obtained from non-smoker/non-drinkers [24,28] With real time PCR technology becoming an increasingly ... provide insight into the epidemiology and natural history of HPV infections within individuals and groups, providing prognostic capability and leading to the development of intervention strategies...
- 17
- 413
- 0
Generation of mouse graves ophthalmopathy model with full length TSH receptor plasmid and cytokine evaluation by real time PCR
... Genetic Immunization in Balb /c versus Swiss Outbred mice 68 2.1.1 Genetic Immunization findings in Balb /c mice 69 2.1.2 Genetic Immunization findings in Swiss Outbred mice 71 2.2 Significance ... receptor The asterisk (*) and double asterisk (**) indicate deletions resulting in a gain of function in hyperfunctioning thyroid adenomas [7] The TSHR is unusual among the GPCRs in that the single-chain ... gene encoding an antigen is cloned into a plasmid with an appropriate promotor, and the plasmid DNA is administered to the vaccine recipient by injection into the subcutaneous tissue or muscles...
- 98
- 145
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... microcystin-RR, -YR, and -LR This bacterium is included in the genus Sphingomonas (accession number AB110635) The strain C- 1 was isolated from Lake Hongfeng in China and this strain is included in the ... microcystin-degrading bacteria, including bacteria without mlrA gene are required Moreover, an increase in the cell number of microcystin-degrading bacteria was observed in the biofilm in autumn at the ... increased with the increase in the concentration of phytoplankton By using methods described in this paper, the behavior of microcystin-degrading bacteria in water environment can be determined, and...
- 9
- 522
- 0
Báo cáo khoa học: "Detection of anatid herpesvirus 1 gC gene by TaqMan™ fluorescent quantitative real-time PCR with specific primers and probe" pps
... tissues (other than kidney) reached a peak at hours postinoculation in AHV-1 Cha strain-infected ducks The concentration of nucleic acid in DNA vaccine-inoculated ducks maintained 107 copies/g level ... viral Genomic (DNA/RNA) extracting kit (Tiangen, China) according to the manufacture’s instructions, then examined by the established FQ-PCR method and conventional PCR under same circumstance ... FQ-PCR is based on the conventional principles of PCR and has being become an increasingly popular way for the diagnosis of bacteria and viruses infection The diagnostic process requires only hours...
- 10
- 293
- 0
Tài liệu Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR pptx
... routine clinical cancer diagnosis We examined the characteristics of four histopathological subtypes in lung cancer cell lines using both statistical analysis and biological network analysis In the ... was not extracted by IPA The connection including CDH1, PLAU, and SMAD4 suggested to be related to cell adhesion by IPA The connection including TGM2, IL1B, and PLAU and the connection including ... examining clinical tissues with DNA microarrays or qPCR First, tissues Page of 12 contain varying amounts of contamination from neighboring stromal cells Second, RNA amplification is required if...
- 12
- 520
- 0
Tài liệu Báo cáo khoa học: Induction of uPA gene expression by the blockage of E-cadherin via Src- and Shc-dependent Erk signaling docx
... interdependence of cadherins and receptor tyrosine kinases with respect to their signaling capacities It has been shown that initiation of de novo E-cadherin-mediated adhesive contacts can induce ligand-independent ... Decma -induced Erk activation is largely dependent on the p46shc and p52shc proteins Involvement of Src and PI3K in Decma -induced Erk activation The E-cadherin adhesion complex is linked to the actin ... signaling cascade (Fig 5B) Again, the Rho kinase inhibitor Y27634 affected neither Decmainduced Erk activation nor Shc phosphorylation and its association with Grb2 (Fig 5B) Interestingly, Src...
- 14
- 599
- 0
báo cáo hóa học:" Whole blood assessment of antigen specific cellular immune response by real time quantitative PCR: a versatile monitoring and discovery tool" potx
... multimer staining of antigen specific T cells, intracellular staining with cytokine specific antibodies, ELISPOT or ELISA assays for antigen driven cytokine production, antigen specific cytotoxicity ... technology in a clinical setting Here we describe a technique capable of detecting antigen specific cellular immune responses with a sensitivity and specificity matching that of current technologies ... genes encoding cytokines and chemokines and anti HBsAg serum titers in vaccinated healthy donors WB from donors naïve or vaccinated with HBsAg was incubated o /n in the presence of a μg/ ml concentration...
- 9
- 438
- 0
Báo cáo sinh học: " Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc
... ranked actin at the last position, indicating that it is an unsuitable reference gene in virus infected cells The actin gene shows significant variations with increasing degree of infection The ... 3) Act showed the highest SD values in all virus infections, but a significantly high correlation In contrast TBP displayed low correlation that was statistically not significant in most cases ... viruses, indicating that Act is no reliable reference gene in this setting In contrast, TBP and PPI displayed the highest expressional stability for of viruses To find a general conclusion, the total...
- 5
- 452
- 0
báo cáo hóa học:" Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc
... ranked actin at the last position, indicating that it is an unsuitable reference gene in virus infected cells The actin gene shows significant variations with increasing degree of infection The ... 3) Act showed the highest SD values in all virus infections, but a significantly high correlation In contrast TBP displayed low correlation that was statistically not significant in most cases ... viruses, indicating that Act is no reliable reference gene in this setting In contrast, TBP and PPI displayed the highest expressional stability for of viruses To find a general conclusion, the total...
- 5
- 539
- 0
Báo cáo khoa học: "Effects of Benzo[a]pyrene, 2-Bromopropane, Phenol and 2,3,7,8-Tetrachlorodibenzo-p-Dioxin on Proinflammatory Cytokines Gene Expression by Mice Spleen Cells" doc
... production of IFN γ is generally considered to be strictly controlled, and significant amounts of this cytokine are only found after specific stimulation or in the course of certain pathologic conditions ... derived from cultured splenocytes (Fig and 5) In mice spleen cells, B[a]P plus anti-CD3 caused no significant change in cytokines gene expression In contrast to B[a]P, 2-BP plus anti-CD3 decreased ... formation within h, whereas DNA fragmentation was absent in unstimulated cells and substantially less in anti-CD3 stimulated cells As shown in Figure 3, the DNA cleavage variations of the different...
- 8
- 420
- 0
Báo cáo y học: "Tumor necrosis factor alpha and epidermal growth factor act additively to inhibit matrix gene expression by chondrocyte" pptx
... Actin cytoskeletal architecture regulates nitric oxide -induced apoptosis, dedifferentiation, and cyclooxygenase-2 expression in articular chondrocytes via mitogen-activated protein kinase and ... Pulsatelli L, Mazzetti I, Borzi RM, Uguccioni M, Facchini A: Enhanced and coordinated in vivo expression of inflammatory cytokines and nitric oxide synthase by chondrocytes from patients with osteoarthritis ... phenotype for some inflammatory mediators Cell survival is essential for ensuring ongoing homeostatic maintenance of cartilage and for bringing about repair to damaged cartilage Maintaining integrity...
- 12
- 388
- 0
Báo cáo khoa học: "Real time PCR analyses of expression of E-cadherin, alpha-, beta- and gamma-catenin in human breast cancer for predicting clinical outcome" pps
... ACATENINF1 ACATENINZR caacccttgtaaacaccaat actgaacctgaccgtacaccttctccaagaaattctca Primers for human β-catenin BCATENINF8 agggattttctcagtccttc BCATENINZF actgaacctgaccgtacacatgccctcatctaatgtct Primers for ... staining Competing interests In conclusion, using real time quantitative PCR we have shown that there is no difference in the expression of Ecahderin, α-, β- and γ-catenin between tumour and normal ... and accelerates invasion and metastasis There are conflicting reports in the literature regarding the relationship between E-cadherin catenin complex and prognosis/survival In this study, E-cadherin...
- 6
- 303
- 0
Báo cáo y học: " Profiles of cytokine and chemokine gene expression in human pulmonary epithelial cells induced by human and avian influenza viruses" doc
... studies on influenza virus -induced inflammatory cytokines have been based on macrophages and monocytes infected in vitro or in vivo [35-37] The mechanism concerning bronchial infiltration of inflammatory ... by the viral components Cytokines and chemokines generally function in an autocrine (on the producing cell itself) or paracrine (on nearby cells) manner Cytokines released following infection can ... an induction of CCL-5/RANTES in avian influenza infection, which may then attract monocytes, eosinophils, basophils, and CD4+ T cells [45] CCL-5/RANTES production from bronchial epithelial cells...
- 9
- 338
- 0
Báo cáo y học: " Detection of porcine parvovirus using a taqman-based real-time pcr with primers and probe designed for the NS1 gene" doc
... chain reaction, immunohistochemistry, and in situ hybridization for the detection of porcine circovirus and porcine parvovirus in experimentally and naturally coinfected pigs J Vet Diagn Invest 2004, ... primers during replication [10] Conclusion In conclusion, the TaqMan real-time PCR assay has been shown to be rapid, sensitive, specific, and reproducible for the detection and quantification ... China 2China Animal Health and Epidemiology Center, Qingdao 266032, China 3Division of Swine Infectious Disease, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute...
- 4
- 587
- 0
báo cáo khoa học: " Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha" ppt
... dehydrogenase and tubulin Specific primers were designed and tested for amplification efficiency, including two sets of primers for an ubiquitin-conjugating enzyme to use as an internal control ... apomictic and sexual reproduction within Brachiaria makes it an interesting system for understanding the molecular pathways involved in both modes of reproduction The identification of genes involved ... then analyzed to verify the specificity of each amplification reaction; the dissociation curve was obtained by heating the amplicon from 4 0C to 10 0C and reading at each C Primer efficiency calculation...
- 10
- 267
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25