Green chemistry and its role for sustainability


... through settling chambers so that sand and similarly gritty material can be removed, skimmers remove floating oil and grease, and floating debris are shredded and ground After this step, the sewage ... size, it shapes itself to its container A liquid, on the other hand, has a definite volume, but does not have a definite shape Only a solid is characterized both by a definite shape and definite ... meaning one half, and sesqui-, meaning one and a half, and per- By the use of these prefixes we can designate the compounds more precisely than by means of the prefixes -ous and -ic, especially...
  • 20
  • 313
  • 2

Tài liệu Báo cáo " English - A global language and its implications for students " ppt

Tài liệu Báo cáo
... language and two ways to make a language global , they are official status and education priority I also have given examples and cite ideas of [1] explanation to the way a language achieve the status ... cannot make a language global , many languages are easy to study in terms of grammar and vocabulary but they are not global Here, I agree with Crystal in respect of his point that a language cannot ... eventually come to be used by more people than any other language [1] How a language becomes a global language There exit several explanations about how a language achieves a global status”...
  • 7
  • 326
  • 4

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
... PDZ -domain- containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to the ... determined the structural and functional properties of the protein protein interaction between v-KIND and MAP2 We defined the binding core regions for the v-KIND–MAP2 interaction and showed that the ... both KIND1 and KIND2; DRasN, deletion of RasN; DGEF, deletion of RasGEF; KIND1, KIND1 domain; KIND2, KIND2 domain (B) KIND2 domain anchors v-KIND to dendrites Flag-tagged v-KIND, DKIND1, DKIND2,...
  • 11
  • 272
  • 0

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCATAGCCATAGCCACTTC C-3¢ (antisense) for exon ... reverse transcriptase (Promega, Madison, WI, USA) For PCR of occludin variants, the primers used were: 5¢-ACTCGACAATGAACAATCCGTCAGAA-3¢ (sense) and 5¢-AGAGTATGCCATGGGACTGTCA-3¢ (antisense) for exon...
  • 12
  • 273
  • 0

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx
... interface formed in the tetramer would disrupt copper < /b> binding < /b> Inhibition of amyloid fibril formation by < /b> stefin < /b> B in presence of copper < /b> The mechanism of amyloid fibril formation of cystatins is being studied ... histidine residues are central to copper < /b> binding < /b> in many proteins they probably form part of the copper < /b> binding < /b> sites in this protein Although there are four histidines in the C-terminal, another ... copper < /b> binding < /b> or loss of its binding < /b> could be related to specific cerebellar function(s) of stefin < /b> B [18], which remains to be seen by < /b> more in vivo studies Stefin < /b> B as a copper < /b> binding < /b> protein We...
  • 14
  • 236
  • 0

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx
... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human AUH protein was first recognized by its ... confirmation of AUH deficiency in fibroblast homogenates In summary, our data show that the main biological function of AUH in human metabolism is the hydration of (E)-3-MG-CoA to (S)-HMG-CoA in the leucine...
  • 11
  • 245
  • 0


... accommodate green chemistry and engineering, such as: Offering green chemistry and engineering electives; and Having laboratory managers incorporate green chemistry and engineering concepts into laboratory ... into green chemistry and engineering by teaching it and speaking about it Green Chemistry and Green Engineering in Future Curriculum The participants identified ways that green chemistry and engineering ... business education; and (5) green ethics This section highlights these overarching ideas PROMOTING GREEN CHEMISTRY AND GREEN ENGINEERING The marketing of green chemistry and green engineering education...
  • 56
  • 169
  • 0

Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc
... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of the L3 cuticle Results Identification of cDNA ... involved in the molting process, we examined the effects of two PPase specific inhibitors, imidodiphosphate (IDP, 1-0631; Sigma) and NaF on development and molting of A suum lungstage L3 to fourth-stage...
  • 13
  • 289
  • 0

Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx

Báo cáo
... which are different in English and Vietnamese are addressed, and implications for teaching English intonation to Vietnamese learners are made Vietnamese words are primarily monosyllabic In the Vietnamese ... aspects of intonation can be easily compared in this study Implications for teaching English intonation to Vietnamese EFL learners The pronunciation mistakes made by people learning to speak a foreign ... foreign language are almost always carry-overs from their native languages Through a comparison of the intonation of Vietnamese with that of English, an EFL instructor can anticipate potential problems...
  • 10
  • 569
  • 4

An Equilibrium Model of Rare-Event Premia and Its Implication for Option Smirks potx

An Equilibrium Model of Rare-Event Premia and Its Implication for Option Smirks potx
... include Gilboa and Schmeidler (1989), Epstein and Wang (1994), Anderson, Hansen, and Sargent (2000), Chen and Epstein (2002), Hansen and Sargent (2001), Epstein and Miao (2003), Routledge and Zin (2002), ... Liu and Pan (2003), Liu, Longstaff, and Pan (2003) and Das and Uppal (2001) Dufresne and Hugonnier (2001) study the impact of event risk on pricing and hedging of contingent claims 132 An Equilibrium ... paper, University of North Carolina, University of Chicago, and Stanford University Bansal, R., A R Gallant, and G Tauchen, 2002, ‘‘Rational Pessimism, Rational Exuberance, and Markets for Macro Risks,’’...
  • 34
  • 244
  • 0

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...
  • 12
  • 274
  • 0

Báo cáo khoa học: "Categorial Fluidity in Chinese and its Implications for Part-of-speech Tagging" pptx

Báo cáo khoa học:
... verbalisation in Chinese was observed in Tai (1997) In other words, verbs are more freely deverbalised than nouns denominalised This fluidity between verbal and nominal status of verbs can in theory ... nouns, and the implications this phenomenon might have for POS tagging References Chinese Knowledge Information Processing Group (CKIP) 1993 iirt,=,m,3 }K (EN) Technical Report no.9305, Academia Sinica, ... LIVAC, A Chinese Synchronous Corpus, and Some Applications In Proceedings of the ICCLC International Conference on Chinese Language Computing, Chicago, pages 233-238 Xia, F 2000 The Part-Of-Speech...
  • 4
  • 150
  • 0

Solar and Space Physics and Its Role in Space Exploration doc

Solar and Space Physics and Its Role in Space Exploration doc
... Printing Office, Washington, D.C., 2004 SOLAR AND SPACE PHYSICS AND ITS ROLE IN SPACE EXPLORATION the fundamental role of solar and space physics research both in scientific exploration and in ... Solar and Space Physics and Its Role in Space Exploration Committee on the Assessment of the Role of Solar and Space Physics in NASA’s Space Exploration Initiative Space Studies ... variations in solar 10 SOLAR AND SPACE PHYSICS AND ITS ROLE IN SPACE EXPLORATION BOX 1.4 Reconnection Explosive events in the Sun’s corona, including solar flares and coronal mass ejections, and in planetary...
  • 74
  • 194
  • 0

Tin Foil and Its Combinations for Filling Teeth docx

Tin Foil and Its Combinations for Filling Teeth docx
... Tin Foil and Its Combinations for Filling by Henry L Ambler Title: Tin Foil and Its Combinations for Filling Teeth Author: Henry L Ambler Release Date: ... ask for something better, for the quality depends largely upon the kind and condition of the tin used and on the method of manufacture For making tin foil for filling teeth, the purest Banca tin ... the tin and gold For filling by hand pressure, use instruments with square ends and sides, medium serrations, and of any form or size which will best reach the cavity For filling with the hand...
  • 49
  • 79
  • 0

Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx

Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx
... oxygen for nucleophilic attack of the a-phosphate of ATP Thus, according to the crystal structure, the specificity of serine recognition depends on: (a) the zinc ion, (b) the size of the active site ... the importance of these residues for the flexibility of the tRNA 3¢-end binding region The ability of the loop to change its conformation upon tRNA binding is crucial for correct positioning of ... binding of the substrates The r.m.s.d of Ca atoms after superposition of the catalytic domains in complex with different substrates and the catalytic domain of the apo-enzyme The binding of the small...
  • 14
  • 143
  • 0

Xem thêm

Từ khóa: neuroimaging for the affective brain sciences and its role in advancing consumer neurosciencethe rise of china soft power and its implications for the united stateschinese soft power and its implications for the united states competitionchinese soft power and its implications for the united statesimportance of tourism industry and its role in the philippine economysummary of a workshop on innovation in computing and information technology for sustainabilitymulti agent methods an example of an architecture and its application for the detection recognition and identification of targetsk nutrition uptake and its role in environmental stress in plantsrediscovering red blood cells revealing their dynamic antigens store and its role in health andembryology structure function and its role in fertilization and infertilityil 12 23 and its role in the immunopathogenesis psoriasissense and nonsense of green chemistry and biofuels4 nucharee premchaiswadi sukanya yimgnagm wichian premchaiswadi a scheme for salt and pepper noise reduction and its application for ocr systemscabling and its rolemolecular functions and its role in virus life cycle and pathogenesisDàn dựng và dạy các bài hát trong chương trình mẫu giáo lớn (5 6 tuổi) trường mầm non bế văn đàn, TP sơn la, tỉnh sơn labài tập và đáp án ôn thi công chức thuế 2017Ebook chế định thẩm phán – một số vấn đề lý luận và thực tiễnphần 1Ebook hướng nào hà nội cũng sông phần 2giải bài tập thuế ôn thi công chức thuế 2017Giáo trình các quy luật địa lý chung của trái đất cảnh quan học phần 2bài tập ôn thi công chức 2017Ebook những phát triển của luật pháp quốc tế trong thế kỷ XXI (sách tham khảo) phần 2Ebook tìm hiểu pháp luật đại cương về nhà nước và pháp luật phần 2Ebook tìm hiểu pháp luật đại cương về nhà nước và pháp luật phần 1Nội dung thi tiếng anhEbook tìm hiểu xét xử hành chính ở một số nước và lãnh thổ trên thế giới (tài liệu tham khảo) phần 1Ebook những phát triển của luật pháp quốc tế trong thế kỷ XXI (sách tham khảo)phần 1bộ câu hỏi trắc nghiệm ôn thi công chức thuế năm 2017Bài giảng luật kinh tế chương 2 (p1) ths đỗ mạnh phươngSLIDE Đồ án môn học: chuẩn bị khoáng sảnThiết kế phân xưởng đậpsàng quặngThiết kế mở vỉa và khai thác cho mỏ thanĐỒ ÁN TỔ CHỨC VÀ QUẢN LÝ THI CÔNGThiết kế website cho bài toán bán hàng qua mạng dựa trên nền tảng wordpressĐồ án kỹ thuật gia công cơ khí II: thiết kế và tính toán Nắp hộp số
Đăng ký
Đăng nhập