Món heo nấu đậu van camp

Lòng gà nấu đậu ván docx

Lòng gà nấu đậu ván docx
... bước thực hiện: Lòng làm sạch, thái nhỏ Dầu nóng phi thơm, cho lòng vào xào săn, thêm cần tây, cải boa rô thái khúc sả thái lát vào đảo Cho nước dùng, nấu sôi, cho bột trứng vào Mách nhỏ: ... lát vào đảo Cho nước dùng, nấu sôi, cho bột trứng vào Mách nhỏ: Cho chút rượu gừng tươi rửa lòng bớt mùi ...
  • 2
  • 188
  • 0

DỰ ĐOÁN LƯỢNG ĐẤT XÓI MÒN TIỀM TÀNG VÀ VẤN ĐỀ PHÂN CẤP ĐẦU NGUỒN KHU VỰC HỒ THUỶ ĐIỆN SƠN LA docx

DỰ ĐOÁN LƯỢNG ĐẤT XÓI MÒN TIỀM TÀNG VÀ VẤN ĐỀ PHÂN CẤP ĐẦU NGUỒN KHU VỰC HỒ THUỶ ĐIỆN SƠN LA docx
... tích lượng đất xói mòn cho cấp xói mòn: Hình Bản đồ xói mòn đất tiềm tàng khu vực nghiên cứu Bảng Thống kê diện tích cấp xói mòn khu vực nghiên cứu Cấp xói mòn Cấp I Cấp II Cấp III Cấp IV Lượng đất ... LUẬN Tổng lượng đất xói mòn tiềm tàng vùng hồ thuỷ điện tỉnh Sơn La dự báo 28,5 triệu tấn/năm, cấp xói mòn III IV chủ yếu Nếu việc phân cấp đầu nguồn dựa vào lượng đất xói mòn tiềm tàng tỷ lệ ... P xác định, dự đoán lượng đất xói mòn cho vị trí bề mặt lưu vực Trên sở tiêu chuẩn Nhà nước số 579/TCVN - 1995 phân chia cấp xói mòn, ta phân chia lưu vực hồ thuỷ điện Sơn La thành cấp, sau tính...
  • 8
  • 326
  • 5

ĐỒ ÁN TỐT NGHIỆP BỘ MÔN: THIẾT BỊ DẦU KHÍ “MÁY BƠM SULZER MSD D4-8-10.5B PHỤC VỤ CHO CÔNG TÁC VẬN CHUYỂN DẦU TẠI MỎ BẠCH HỔ”. potx

ĐỒ ÁN TỐT NGHIỆP BỘ MÔN: THIẾT BỊ DẦU KHÍ “MÁY BƠM SULZER MSD D4-8-10.5B PHỤC VỤ CHO CÔNG TÁC VẬN CHUYỂN DẦU TẠI MỎ BẠCH HỔ”. potx
... piston, mỏy bm ly tõm, mỏy bm hng trc, mỏy bm phun tia,mi loi mỏy bm cú mt cụng dng v phm vi s dng khỏc Trong cụng tỏc chuyn du khớ, ngi ta thng s dng mỏy bm ly tõm vỡ so vi cỏc loi mỏy bm khỏc mỏy ... ó giỳp em hon thnh ỏn tt nghip: MY BM SULZER MSD D4-8-10.5B PHC V CHO CễNG TC VN CHUYN DU TI M BCH H Chuyờn : Tớnh toỏn khp truyn ng ca mỏy bm chuyn du Sulzer Ni dung ca ti gm chng: Chng I: ... loi mỏy bm ly tõm bm chuyn du khớ Thng cú hai mỏy bm Sulzer, mt mỏy bm luụn trng thỏi lm vic v mt mỏy bm d phũng, c ghộp song song nhm mc ớch: - m bo quỏ trỡnh khai thỏc c liờn tc, nu mỏy...
  • 46
  • 572
  • 1

Bước đầu vận dụng Dạy học chương trinh hóa vào việc giảng dạy một số nội dung trong môn Đại số lớp 10 Trung học phổ thông

Bước đầu vận dụng Dạy học chương trinh hóa vào việc giảng dạy một số nội dung trong môn Đại số lớp 10 Trung học phổ thông
... Bớc đầu vận dụng Dạy học chơng trình hóa vào việc giảng dạy số nội dung môn Đại số lớp 10 Trung học phổ thông Mục đích nghiên cứu Mục đích luận văn vận dụng Dạy học chơng trình hóa vào việc giảng ... Chơng Vận dụng Dạy học chơng trình hóa vào việc giảng dạy số nội dung môn Đại số lớp 10 THPT 2.1 Quy trình xây dựng Chơng trình Dạy học chơng trình hóa cho số nội dung môn Đại số lớp 10 THPT Thông ... trình Dạy học chơng trình hóa cho số nội dung môn Đại số lớp 10 THPT 2.2 Xây dựng tài liệu Chơng trình hóa cho dạy học số nội dung môn Đại số lớp 10 THPT 2.3 Tổ chức Dạy học chơng trình hóa cho số...
  • 105
  • 217
  • 2

TIỂU LUẬN MÔN: CÔNG NGHỆ CHẾ BIẾN ĐỒ HỘP gà nấu đậu

TIỂU LUẬN MÔN: CÔNG NGHỆ CHẾ BIẾN ĐỒ HỘP gà nấu đậu
... xuất đồ hộp nấu đậu Quy trình sản xuất đồ hộp nấu đậu Thanh trùng Làm nguội Chần ghép mí Đậu trắng, cà rốt Xử lý sơ Đun nóng Chà Phối chế Cô đặc Cà chua Gia vị Rửa Sấy khô Hộp Thịt Rã ... Tinh bột biến tính…………………………………………………………………12 1.5.9 Nước……………………………………………………………………………….13 Chương II Quy trình sản xuất đồ hộp nấu đậu …………………………………… 14 Quy trình sản xuất đồ hộp nấu đậu …………………………………………… ... trường hay sử dụng Chương III Bao bì đồ hộp nấu đậu Sơ lược bao bì đồ hộp Trong sản xuất đồ hộp thường sử dụng nhóm bao bì : 1.1 Bao bì gián tiếp: Để đựng đồ hộp thành phẩm, tạo thành kiện hàng,...
  • 36
  • 265
  • 1

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 7 doc

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 7 doc
... ACAGGAAGGACAACACTCAC : || :: : 3' CACTCACAACAGGAAGGACA -1, 57 5' ACAGGAAGGACAACACTCAC || : : :: 3' CACTCACAACAGGAAGGACA -1, 57 226 -1.6 -1.6 225 5' ACAGGAAGGACAACACTCAC || :: 3' CACTCACAACAGGAAGGACA ... ACAGGAAGGACAACACTCAC : || 3' CTAACGAACTTCAAACACGC -1, 57 5' ACAGGAAGGACAACACTCAC : || : 3' CTAACGAACTTCAAACACGC -1, 57 5' ACAGGAAGGACAACACTCAC || : : : 3' CTAACGAACTTCAAACACGC -1, 57 5' ACAGGAAGGACAACACTCAC || : : ... CGCACAAACTTCAAGCAATC || :: :: :: 3' CTAACGAACTTCAAACACGC CGCACAAACTTCAAGCAATC || :: 3' CTAACGAACTTCAAACACGC 64 -1,94 5' CGCACAAACTTCAAGCAATC || :: 3' CTAACGAACTTCAAACACGC -1, 47 5' CGCACAAACTTCAAGCAATC...
  • 6
  • 125
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 6 doc

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 6 doc
... cho PMWaV-1 Điều khẳng định độ tin cậy quy trình RT-PCR vừa xây dựng Tỷ lệ nhiễm PMWaV-1 giống dứa Cayenne giám định cao, giống Thái Lan: 53,3%, giống Trung Quốc: 46, 7% giống Lâm Đồng: 46, 7% ... vùng dứa khác để đánh giá xác tình hình bệnh héo đỏ đầu nhiễm PMWaV-1 nước Kết hợp với quy trình phát PMWaV-2 xử lý nhiệt – nuôi cấy mô dứa để xây dựng mô hình cung cấp nguồn giống dứa virus ... nguy lớn bệnh héo đỏ đầu đe dọa người trồng dứa đòi hỏi cấp thiết phương pháp phòng trừ bệnh hiệu 4.2 Đề nghị Với kết luận rút trên, để tiếp tục phát triển hiệu đề tài, đưa số đề nghị sau: Tiếp...
  • 10
  • 95
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 5 ppt

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 5 ppt
... quy trình RT-PCR trình bày phần phương pháp thực chu trình khảo sát với mẫu RNA ly trích từ bệnh cho kết sau: 46 L 1 .50 0 bp 50 0 bp 58 9 bp Hình 4. 2: Sản phẩm RT-PCR chu trình nhiệt Chú thích: L: ... cần thiết để đánh giá xác diện PMWaV-1 Như vậy, kết luận quy trình RT-PCR xây dựng hoàn toàn đủ độ tin cậy việc phát PMWaV-1 Hình 4. 5: Sơ đồ phản ứng RT-PCR phát PMWaV-1 ... sau: 49 L 58 9 bp 50 0 bp Hình 4. 4: Kết khảo sát số chu kỳ RT-PCR thích hợp Chú thích: L: Ladder Giếng 1: sản phẩm RT-PCR với 41 chu kỳ Giếng 2: sản phẩm RT-PCR với 42 chu kỳ Giếng 3: sản phẩm RT-PCR...
  • 10
  • 142
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 4 pptx

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 4 pptx
... tắc trên, phản ứng RT-PCR tối ưu khảo sát dựa chu trình sau Bảng 3. 1: Các chu trình nhiệt phản ứng RT-PCR khảo sát Giai đoạn Chu trình nhiệt 45 oC /45 45 oC /45 45 oC /45 ’ 94oC/2’ 94oC/2’ 94oC/2’ 94oC/2’ ... 52oC/1’ 54oC/1’ 56oC/1’ 58oC/1’ 58oC/1’ 68oC/1’30’’ 68oC/1’30’’ 68oC/1’30’’ 68oC/1’30’’ (45 chu kỳ) cDNA 45 oC /45 ’ 68oC/1’30’’ Khuếch đại 45 oC /45 ’ 94oC/2’ Tạo cDNA (45 chu kỳ) (45 chu kỳ) (45 chu ... mM 0,6 mM 3.2.3 .4 Xác định số chu kỳ phản ứng tối ưu Phản ứng RT-PCR thực mức 41 , 42 , 43 , 44 , 45 chu kỳ để xác định số chu kỳ cho hiệu khuếch đại tối ưu 3.3 .4 Điện di sản phẩm RT-PCR Sản phẩm...
  • 10
  • 152
  • 1

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 3 potx

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 3 potx
... tư lớn cho dứa (chương trình cây, thành phố Hồ Chí Minh) cần phải xây dựng quy trình phòng trừ bệnh thật hiệu Từ thành nghiên cứu thực giới, ta đề mô hình phòng trừ bệnh héo đỏ đầu sau: Xử lý nhiệt ... 2.6 Các phương pháp chẩn đoán PMWaV Từ nghiên cứu bệnh héo đỏ đầu thực giới cho thấy, có phương pháp để chẩn đoán PMWaV-1 dứa - Phương pháp ELISA (Enzyme Linked Immuno Sorbent Assay ): năm 1978, ... công phương pháp để chẩn đoán bệnh virus hại khoai tây Phương pháp hoạt động dựa nguyên tắc kháng nguyên – kháng thể Hiện phương pháp huyết đại nhanh chóng để chẩn đoán bệnh virus 25 - Phương pháp...
  • 10
  • 109
  • 0

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 1 pdf

Luận văn : XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV-1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR part 1 pdf
... NGHỆ SINH HỌC ***000*** KHÓA LUẬN TỐT NGHIỆP XÂY DỰNG QUY TRÌNH PHÁT HIỆN VIRUS PMWaV -1 GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (Mealybug wilt) TRÊN CÂY DỨA CAYENNE BẰNG PHƯƠNG PHÁP RT-PCR Giáo viên hướng dẫn Sinh ... HÌNH TRANG Hình 2. 1: Cây dứa Hình 2. 2: Dứa Cayenne Hình 2. 3: Cây dứa Cayenne bị héo đỏ đầu 10 Hình 2. 4: Quả dứa bị héo đỏ đầu 10 Hình 2. 5: Rệp xám (Dysmicoccus ... thụ dứa giới Việt Nam 2.4 Bệnh héo đỏ đầu dứa 2.5 Một số nghiên cứu bệnh héo đỏ đầu giới Việt Nam 13 2.6 Các phương pháp chẩn đoán PMWaV 15 2.7 Gene HSP 70 PMWaV -1 .16 ...
  • 10
  • 115
  • 0

Luận văn : NGHIÊN CỨU TẠO CÂY DỨA CAYENNE IN VITRO SẠCH VIRUS GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (PMWaV- Pineapple mealybug wilt associated virus) part 9 ppt

Luận văn : NGHIÊN CỨU TẠO CÂY DỨA CAYENNE IN VITRO SẠCH VIRUS GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (PMWaV- Pineapple mealybug wilt associated virus) part 9 ppt
... 70875 69 AB 6333333 147 893 3 33 590 59 9307608 1 91 11111 147 893 3 6136836 1.2085386 1.2555556 147 893 3 95 81281 1.55 298 30 38888 89 147 893 3 091 4614 6863164 4666667 147 893 3 1 692 392 764 094 1 3111111 147 893 3 ... 0603772 5 396 8 69 7825354 A:DR70.giong 18 7722222 1045764 56 190 92 98 25352 18 8222222 1045764 61 190 92 1.0325352 18 38888 89 1045764 17857 59 599 20 19 B:DR70.xln 27 7851852 0853862 6134654 95 690 50 27 ... 54 2.8333333 199 0202 2.4330848 3.23358 19 A:SR70.giong 18 3.1666667 3447132 2.4734158 3.8 599 175 18 2.6666667 3447132 1 .97 34158 3.3 599 175 18 2.6666667 3447132 1 .97 34158 3.3 599 175 B:SR70.xln 27 3.1851852...
  • 6
  • 95
  • 0

Luận văn : NGHIÊN CỨU TẠO CÂY DỨA CAYENNE IN VITRO SẠCH VIRUS GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (PMWaV- Pineapple mealybug wilt associated virus) part 8 pdf

Luận văn : NGHIÊN CỨU TẠO CÂY DỨA CAYENNE IN VITRO SẠCH VIRUS GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (PMWaV- Pineapple mealybug wilt associated virus) part 8 pdf
... 4.5 185 185 389 989 6 3.7342124 5.30 282 47 27 5.1111111 389 989 6 4.32 680 50 5 .89 54173 AB 4.77777 78 675 481 8 3.4193197 6.1362359 1 5.5555556 675 481 8 4.1970975 6.9140137 4 .88 888 89 675 481 8 3.53043 08 6.2473470 ... 54 83 42593 0530411 727 588 6 9409299 A:C50.giong 18 1.0500000 09 186 99 86 52410 1.2347590 18 80277 78 09 186 99 6 180 188 987 53 68 18 6500000 09 186 99 4652410 83 47590 B:C50.xln 27 9166667 0750114 76 581 16 ... 1902096 2. 987 84 08 3.7529000 A:L30.giong 18 3. 388 888 9 3294527 2.7263 282 4.0514496 18 3.2222222 3294527 2.5596615 3 .88 4 782 9 18 3.5000000 3294527 2 .83 74393 4.1625607 B:L30.xln 27 2.7037037 2 689 970 2.1627252...
  • 10
  • 154
  • 0

Luận văn : NGHIÊN CỨU TẠO CÂY DỨA CAYENNE IN VITRO SẠCH VIRUS GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (PMWaV- Pineapple mealybug wilt associated virus) part 7 doc

Luận văn : NGHIÊN CỨU TẠO CÂY DỨA CAYENNE IN VITRO SẠCH VIRUS GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (PMWaV- Pineapple mealybug wilt associated virus) part 7 doc
... 15.4 074 07 7 .70 370 37 3.906 0234 BC 0 370 37 0 370 370 019 89 27 ABC 1.4 074 07 70 370 37 3 57 7008 RESIDUAL 189.33333 96 1. 972 2222 -TOTAL (CORRECTED) 295.18519 1 07 ... of pineapple in Hawaii Plant Disease 8 6:8 67- 874 20 Sipes, B S., Sether D M., and Hu J S., 2002 Interactions between Rotylenchus reniformis and Pineapple mealybug wilt associated virus- 1 in pineapple ... -MAIN EFFECTS A:TGTAIS1.giong 1.185185 592593 300 74 12 B:TGTAIS1.xln 1.814815 1.814815 920 3501 C:TGTAIS1.kt_mau 71 .70 370 4 71 .70 370 4 36.3 57 0000 INTERACTIONS AB 14.296296 7. 1481481 3.624...
  • 10
  • 76
  • 0

Luận văn : NGHIÊN CỨU TẠO CÂY DỨA CAYENNE IN VITRO SẠCH VIRUS GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (PMWaV- Pineapple mealybug wilt associated virus) part 6 pdf

Luận văn : NGHIÊN CỨU TẠO CÂY DỨA CAYENNE IN VITRO SẠCH VIRUS GÂY BỆNH HÉO ĐỎ ĐẦU LÁ (PMWaV- Pineapple mealybug wilt associated virus) part 6 pdf
... PMWaV-1 Giếng 1: thang chuẩn với kích thước từ 100 – 1500 bp Giếng 2, 3, 4: mẫu Cayenne Trung Quốc Giếng 5: đối chứng dương Giếng 6, 7, 8: mẫu Cayenne Thái Lan Giếng 9, 10, 1 1: mẫu Cayenne Lâm Đồng ... a a ab 6, 11 Xử lí - 1, 2, 2,70a 4,52a 6, 22a nhiệt + 4, 5, 4,04b 5,11a 6, 33a Ghi ch : TQ: Trung Quốc, TL: Thái Lan, L : Lâm Đồng (- ): không xử lí nhiệt, (+ ): xử lí nhiệt Trong cột yếu tố ảnh hưởng, ... TL 2, 0,94a 2 ,67 a LĐ Giống 1, 3, 1,00ab 2 ,67 a Xử lí - 1, 2, 1,11a 3,19a nhiệt + 4, 5, 1,40a 2,48a Ghi ch : TQ: Trung Quốc, TL: Thái Lan, L : Lâm Đồng (- ): không xử lí nhiệt, (+ ): xử lí nhiệt...
  • 10
  • 105
  • 0

Xem thêm

Nạp tiền Tải lên
Đăng ký
Đăng nhập