Luận án tiến sĩ nghiên cứu quá trình chế biến cao lanh phú thọ để sản xuất các hợp chất của nhôm (TT)

Nghiên cứu quá trình chế biến cao lanh Phú Thọ để sản xuất các hợp chất của nhôm

Nghiên cứu quá trình chế biến cao lanh Phú Thọ để sản xuất các hợp chất của nhôm
... luận án là: Nghiên cứu trình chế biến cao lanh Phú Thọ để sản xuất hợp chất nhôm Mục tiêu luận án: - Điều chế hợp chất nhôm từ cao lanh Phú Thọ - Sản xuất phèn kép kali - nhôm sunfat, chất keo ... tích cao lanh chất lượng tương đối tốt, sắt tạp chất cao lanh dùng để nghiên cứu luận án để sản xuất hợp chất nhôm thu hồi SiO2 Cao lanh huyện Thanh Sơn tỉnh Phú Thọ (Cao lanh Phú Thọ) dùng để ... DỤC VÀ ĐÀO TẠO TRƢỜNG ĐẠI HỌC BÁCH KHOA HÀ NỘI VŨ MINH KHÔI NGHIÊN CỨU QUÁ TRÌNH CHẾ BIẾN CAO LANH PHÚ THỌ ĐỂ SẢN XUẤT CÁC HỢP CHẤT CỦA NHÔM Chuyên ngành: Kỹ thuật Hóa học Mã số: 62520301 LUẬN ÁN...
  • 139
  • 184
  • 0


... 116 nm men sinh bia non quỏ trỡnh lờn men bia nng cao s dng nm men c nh gel alginate v nm men t Bng 3.18: S mole c cht hoc sn phm tớnh theo mole ng lờn men quỏ 116 trỡnh lờn men bia nng cao s ... nghiờn cu nc v lờn men bia nng cao s dng nm men c nh gel alginate hu nh cha c cụng b i vi nhng kt qu ó cụng b nc ngoi, nhng nghiờn cu v lờn men bia nng cao s dng nm men c nh gel alginate cha cp ... nm men gel alginate lờn men bia nng cao: Trc õy, mt s tỏc gi ó xỏc nh cỏc thụng s k thut ti u ca quỏ trỡnh c nh nm men gel alginate vi mc ớch s dng lờn men sn xut cn, lờn men ru vang, lờn men...
  • 278
  • 222
  • 0

Luận án tiến Nghiên cứu quá trình hole burning phổ bền vững trong một số vật liệu thủy tinh oxit pha tạp Eu

Luận án tiến sĩ Nghiên cứu quá trình hole burning phổ bền vững trong một số vật liệu thủy tinh oxit pha tạp Eu
... VIỆN KHOA HỌC VẬT LIỆU    NGUYỄN TRỌNG THÀNH NGHIÊN CỨU QUÁ TRÌNH HOLE- BURNING PHỔ BỀN VỮNG TRONG MỘT SỐ VẬT LIỆU THỦY TINH ÔXIT PHA TẠP Eu LUẬN ÁN TIẾN SĨ KHOA HỌC VẬT LIỆU HÀ NỘI ... trình hole burning phổ bền vững số vật liệu thủy tinh oxit pha tạp Eu Mục tiêu luận án: - Chế tạo hệ vật liệu thuỷ tinh fluoroalumninoborate-Na (Ca) pha tạp ion Eu3 + với tỉ lệ thành phần tạp khác ... hole burning vật liệu thủy tinh pha tạp Sm2+ (cho trình: photon photon) Nguyên lí kích thích lọc lựa phổ huỳnh quang vạch hẹp ion Eu3 + vật liệu thủy tinh Quy trình chế tạo vật liệu thủy tinh...
  • 161
  • 222
  • 1


... khác để bảo vệ chống ăn mòn cho công trình, kết cấu thép quan trọng Protector Zn ứng dụng bảo vệ công trình bê tông cốt thép tiếp xúc với nước cầu cảng, công trình quân dân biển đảo, bảo vệ vỏ ... tập trung vào nghiên cứu thành phần vật liệu chế tạo protector Hiện có công trình nghiên cứu công nghệ chế tạo protector để nâng cao hiệu bảo vệ ứng dụng thực tế Phương pháp chế tạo protector ... Tốc độ ăn mòn thép CT51 bảo vệ protector Zn chế tạo phương pháp bán lỏng nước biển 82 So sánh tốc độ ăn mòn thép CT51 chế độ nước biển 83 4.5.2 Thử nghiệm thép CT51 môi...
  • 131
  • 307
  • 1

tóm tắt luận án tiến Nghiên cứu mô phỏng tính biến động và quá trình lan truyền bụi PM10 trong môi trường không khí ở Hà Nội

tóm tắt luận án tiến sĩ Nghiên cứu mô phỏng tính biến động và quá trình lan truyền bụi PM10 trong môi trường không khí ở Hà Nội
... động trình lan truyền bụi PM10 môi trường không khí Nội với hy vọng đóng góp phần kết nghiên cứu việc ứng dụng hình hóa trình lan truyền bụi PM10 tuyến đường giao thông tính biến động ... lý bảo vệ môi trường không khí thủ đô nói riêng nước ta nói chung Mục tiêu nghiên cứu - Nghiên cứu đặc tính biến động bụi PM10 môi trường không khí Nội; - Thiết lập hình nội, ngoại suy ... đổi không dừng hàm cấu trúc PM10; - Lựa chọn hình CAL3QHC để lan truyền bụi PM10 từ nguồn giao thông thành phố Nội Đây hình Cục Bảo vệ môi trường Mỹ phát triển để nghiên cứu lan truyền...
  • 23
  • 157
  • 0

Luận án tiến sỹ nghiên cứu quá trình thủy phân protein cá bằng enzym protease từ b.subtilis s5

Luận án tiến sỹ nghiên cứu quá trình thủy phân protein cá bằng enzym protease từ b.subtilis s5
... nuoi B.subtilis 55 d~ san xua't protease 8 3.1.2 Xac dinh kha Dang san xua't protease cua B.subtilis 55 di~u ki~n co thong gio va khOng thong gio Tie'n hflOh san xua't protease tif B.subtilis S5 ... thich h...
  • 31
  • 530
  • 2


... phn tinh du v curcuminoid c Ngh vng (Curcuma longa L.) Bỡnh Dng, kho sỏt quy trỡnh tỏch curcuminoid kt hp tỏch tinh du t nguyờn liu ngh ti v ngh khụ ó nghiờn cu quy trỡnh phõn lp thnh phn curcuminoid ... 2.3.1 Nghiờn cu trớch ly curcuminoid v tinh du t c Ngh vng (Curcuma longa L.) Bỡnh Dng Kho sỏt quy trỡnh trớch ly curcuminoid v tinh du t c ngh Curcuminoid v tinh du u l nhng thnh phn ... cu - Nghiờn cu quy trỡnh trớch ly curcuminoid v tinh du t c Ngh vng (Curcuma Longa L.) Bỡnh Dng - Phõn lp thnh phn curcumin, DMC v BDMC t hn hp curcuminoid - Tng hp dn xut ca curcuminoid - Kho...
  • 158
  • 453
  • 6

tóm tắt luận án tiến nghiên cứu công nghệ chế tạo nano tio2 và ứng dụng tạo màng phủ trên vật liệu gốm sứ

tóm tắt luận án tiến sĩ nghiên cứu công nghệ chế tạo nano tio2 và ứng dụng tạo màng phủ trên vật liệu gốm sứ
... CHƯƠNG TỔNG QUAN Tóm tắt tình hình nghiên cứu liên quan đến đề tài luận án Nghiên cứu công nghệ chế tạo nano TiO2 ứng dụng tạo màng phủ vật liệu gốm sứ 1.1 Vật liệu TiO2 ứng dụng Từ năm 1964, ... nano TiO2 ứng dụng tạo màng phủ vật liệu gốm sứ hữu dụng cần thiết CHƯƠNG PHƯƠNG PHÁP NGHIÊN CỨU 2.1 Phương pháp nghiên cứu chế tạo vật liệu nano TiO từ TTIP Phương pháp chế tạo màng phủ nano TiO2 ... sơn phủ chống kháng khuẩn nano TiO2 1.5 Ứng dụng TiO2 Việt Nam Những nghiên cứu ứng dụng nano TiO2 triển khai hầu hết sở nghiên cứu hàng đầu Việt Nam vòng 10 năm trở lại đây: nghiên cứu ứng dụng...
  • 24
  • 238
  • 0

tóm tắt luận án tiến nghiên cứu phương pháp tính ổn định mái dốc có xét đến điều kiện tương thích của lực tương tác ứng dụng cho xây dựng đê biển

tóm tắt luận án tiến sĩ nghiên cứu phương pháp tính ổn định mái dốc có xét đến điều kiện tương thích của lực tương tác   ứng dụng cho xây dựng đê biển
... cụng trỡnh bỏn vnh cu 1.1.2 bin cú th phi cho trn nc: Vi iu kin t nhiờn khc nghit, iu kin kinh t cha cho phộp thỡ bin Vit Nam hin v nhng nm ti nhiu phi cho trn nc Tuy nhiờn, bin l cụng trỡnh ... mỏi dc cú ct VKT thng dựng hin nay: Xỏc nh lc kộo lờn h ct: Hin nay, cú 02 phng phỏp thng dựng tớnh toỏn lc kộo ca ct: (i) Xỏc nh lc kộo ca h vi theo phng phỏp dựng biu ca Schmertmann ...*) (2.22) (2.23) a/ Sơ đồ lực tổng quát Xi-1 R i-1 O H ớng tr ợt Ei-1 I Ei = E i-1+ Ei Ti Ni Ni Ri Wi S Đ ờng Coulomb Xi= Xi-1+ X i b/ Sơ đồ lực rút gọn t ơng đ ơng H Wi Ti M ...
  • 27
  • 333
  • 0

Luận án tiến Nghiên cứu xác định đột biến gen F8 gây bệnh hemophilia A (NCS: Lưu Vũ Dũng )

Luận án tiến sĩ Nghiên cứu xác định đột biến gen F8 gây bệnh hemophilia A (NCS: Lưu Vũ Dũng )
... xác định đột bi n đảo đoạn intron 22 gen F8 [78] Tên mồi Trình tự ID (mồi xuôi gen F 8) ACATACGGTTTAGTCACAAGT IU (mồi ngƣợc gen F 8) CCTTTCAACTCCATCTCCAT ED (mồi xuôi gen F 8) TCCAGTCACTTAGGCTCAG ... Phát đột biến gen F8 bệnh nhân hemophilia A Việt Nam Bước đầu xây dựng đồ đột biến gen F8 bệnh nhân hemophilia A Việt Nam 3 Chƣơng TỔNG QUAN 1.1 LỊCH SỬ NGHIÊN CỨU BỆNH HEMOPHILIA A Từ thời ... đột biến gen F8 gây bệnh hemophilia A Hiện nay, hàng năm có nhiều đột biến đƣợc công bố sở liệu HAMSTeRS (Hemophilia A Mutation, Search, Test and Resource Site) trang quản lý thông tin bệnh hemophilia...
  • 143
  • 300
  • 2

tóm tắt luận án tiến Nghiên cứu thiết kế chế tạo động cơ sử dụng hai nhiên liệu BiogasDiesel trên cơ sở động cơ một xi lanh tĩnh tại

tóm tắt luận án tiến sĩ Nghiên cứu thiết kế chế tạo động cơ sử dụng hai nhiên liệu BiogasDiesel trên cơ sở động cơ một xi lanh tĩnh tại
... tính động 3.3 KẾT LUẬN 12 Chương 4: THIẾT KẾ CHẾ TẠO ĐỘNG CƠ HAI NHIÊN LIỆU BIOGAS/DIESEL VIKYNO EV2600-NB-BIO TRÊN CƠ SỞ ĐỘNG CƠ MẪU VIKYNO EV2600-NB 4.1 THIẾT KẾ BỘ TẠO HỖN HỢP 4.1.1 Tính toán ... cầu thiết kế chuyển đổi 2.3.3 Xác định phương án nghiên cứu tính toán thiết kế Khi chuyển đổi động diesel xi lanh thành động hai nhiên liệu biogas/diesel, số phận động phải thiết kế chế tạo hoặc ... để chế tạo hoàn thiện cung cấp cho thị trường để người sử dụng mua sử dụng với chi phí hợp lý độ tin cậy thiết bị cao nhu cầu cấp thiết Do Nghiên cứu thiết kế chế tạo động sử dụng hai nhiên liệu...
  • 27
  • 167
  • 0

tóm tắt luận án tiến nghiên cứu tác động của quá trình chuyển đổi cơ cấu sử dụng đất đến phát triển nông nghiệp, nông thôn huyện văn lâm, tỉnh hưng yên

tóm tắt luận án tiến sĩ nghiên cứu tác động của quá trình chuyển đổi cơ cấu sử dụng đất đến phát triển nông nghiệp, nông thôn huyện văn lâm, tỉnh hưng yên
... bàn huyện Văn Lâm 3.3.4 Xác định mức độ tác động chuyển đổi cấu sử dụng đất đến phát triển nông nghiệp, nông thôn Để xác định mức độ tác động chuyển đổi cấu sử dụng đất đến phát triển nông nghiệp, ... tiêu nghiên cứu + Xác định tác động trình chuyển đổi cấu sử dụng đất đến nông nghiệp, nông thôn huyện Văn Lâm, tỉnh Hưng Yên + Đề xuất giải pháp nâng cao hiệu trình thực chuyển đổi cấu sử dụng đất ... để phát triển bền vững? Xuất phát từ vấn đề nêu trên, việc thực đề tài: "Nghiên cứu tác động trình chuyển đổi cấu sử dụng đất đến phát triển nông nghiệp, nông thôn huyện Văn Lâm, tỉnh Hưng Yên ...
  • 27
  • 337
  • 2

tóm tắt luấn án tiến nghiên cứu tác động của quá trình công nghiệp hóa đến quản lý, sử dụng đất nông nghiệp và đời sống người dân huyện quế võ, tỉnh bắc ninh

tóm tắt luấn án tiến sĩ nghiên cứu tác động của quá trình công nghiệp hóa đến quản lý, sử dụng đất nông nghiệp và đời sống người dân huyện quế võ, tỉnh bắc ninh
... trạng trình CNH huyện Quế Võ, tỉnh Bắc Ninh - Tác động trình CNH đến quản lý, sử dụng đất nông nghiệp huyện Quế Võ, tỉnh Bắc Ninh - Tác động trình CNH đến đời sống người dân huyện Quế Võ, tỉnh Bắc ... 3.4 Tác động trình công nghiệp hóa đến quản sử dụng đất nông nghiệp 3.4.1 Tác động trình công nghiệp hóa đến quản đất nông nghiệp Đẩy nhanh việc ban hành văn pháp luật quản đất ... đích nghiên cứu - Đánh giá thực trạng tác động trình CNH đến tình hình quản lý, sử dụng đất đời sống người dân huyện Quế Võ, tỉnh Bắc Ninh; - Đề xuất số giải pháp nhằm tăng cường hiệu công tác quản...
  • 24
  • 261
  • 0

tóm tắt luận án tiến Nghiên cứu sự chuyển hóa của một số yếu tố gây ô nhiễm trong quá trình ổn định bùn thải kết hợp rác hữu cơ bằng phương pháp lên men nóng

tóm tắt luận án tiến sĩ Nghiên cứu sự chuyển hóa của một số yếu tố gây ô nhiễm trong quá trình ổn định bùn thải kết hợp rác hữu cơ bằng phương pháp lên men nóng
... hợp rác hữu phƣơng pháp lên men nóng 3.3.1 Các thông số hóa trình lên men yếm khí Xem xét tổng hợp thay đổi thông số hóa trình ổn định bùn thải sông Kim Ngưu kết hợp rác hữu phương pháp lên ... kiện tối ưu ổn định bùn thải kết hợp rác hữu phương pháp lên men yếm khí nóng Thực nghiệm xác định điều kiện tối ưu tỷ lệ phối trộn thích hợp ổn định bùn thải kết hợp rác hữu phương pháp lên men ... quy trình xử bùn thải ô thị Việt Nam nói chung bùn thải thành phố Hà Nội nói riêng, chọn đề tài Nghiên cứu chuyển hóa số yếu tố gây ô nhiễm trình ổn định bùn thải kết hợp rác hữu phương pháp lên...
  • 27
  • 151
  • 0

Xem thêm

Từ khóa: luan an tien si nghien cuu phat trien ben vungluan van tot nghiep nghien cuu quy trinh che bien khom sayđồ án tốt nghiệp nghiên cứu quy trình chế biến nước ép khế đóng chailuận án tiến sĩ kinh tế hoàn thiện quản lý nhà nước đối với thuế thu nhập các nhân ở việt namnghiên cứu quy trình chế biến trà túi lọc từ quả sung ficus glomerata và khảo sát hoạt tính sinh học của sản phẩmnghiên cứu sự ảnh hưởng của quá trình chế biến đến thành phần acid béo trong một các sản phẩm từ đậu tươngnghiên cứu quy trình chế biến mứt ổi đôngnghiên cứu quy trình chế biến phân compost từ rác sinh hoạt tại thành phố đà lạtnghien cuu quy trinh che bienquá trình chế biến cao sunghiên cứu xác định giống và một số biện pháp kỹ thuật tăng năng suất và hiệu quả kinh tế trong sản xuất cà chua tại đồng bằng sông hồng luận án tiến sĩ nông nghiệp hμ néiluận án tiến sĩ y học nghiên cứu hiệu quả thắt giãn tĩnh mạch thực quản kết hợp propranolol trong dự phòng xuất huyết tái phát và tác động lên bệnh dạ dày tăng áp cửa do xơ ganhướng dẫn nghiên cứu và viết luận án tiến sĩđề cương nghiên cứu luận án tiến sĩluận án tiến sĩ địa chất nghiên cứu lựa chọn mô hình đánh giá tài nguyên trữ lượng vàng gốc vùng phước sơn quảng namKhảo sát thành phần hóa học cây ô môi (Cassia grandis L.f), họ Đậu (Fabaceae) ở đồng bằng sông Cửu LongĐánh giá 2 kỹ thuật dùng cho giám sát đo tải lượng HIV trên mẫu DBS, dự án ANRS 12338Nguyên lý sử dụng vi sinh vật trong xử lý chất thảiSản Phẩm Mực Tẩm Bột Xù Đông LạnhRối Loạn Khí Sắc (Mood Disorders)Khảo Sát Hiện Trạng Ô Nhiễm Arsen Trong Nước Ngầm Và Đánh Giá Rủi Ro Lên Sức Khỏe Cộng Đồng Tại Hai Huyện Đơn Dương Và Đức Trọng - Tỉnh Lâm ĐồngThỏa thuận trọng tài vô hiệu theo pháp luật trọng tài thương mại ở Việt Nam hiện nayChăm sóc người nhiễm HIV dùng chất gây nghiệnModule Tìm tin trong môi trường điện tửgiáo trình nguon xungBài Giảng Các Quốc Gia Ấn Và Văn Hoá Truyền Thống Ấn ĐộChuyên đề “tổ chức dạy học theo chủ đề tích hợp”Bài giảng KHU CÔNG NGHIỆP SINH THÁIBài giảng QUAN SÁT MỘT SỐ THÂN MÊMBài giảng VIÊM PHÚC MẠCBài giảng SINH LÝ PHỤ KHOABài giảng VỆ SINH DABài Giảng Quy Trình Tổ Chức Bữa ĂnBài giảng kế hoạch hóa gia đìnhBài Giảng Sự Phát Triển Của Kỹ Thuật, Khoa Học, Văn Học Và Nghệ Thuật Thế Kỷ XVIII-XIX