Sử dụng kỹ thuật vi gel để vi bao vi khuẩn lactobacillus acidophilus

Báo cáo khoa học: "Ph-ơng pháp nâng cao độ tin cậy và khả năng chống nhiễu khi thiết kế mạch điện tử sử dụng kỹ thuật vi xử lý" pdf

Báo cáo khoa học:
... hình nối đất hình thiết kế mạch in Trên trình bày vài phơng pháp nâng cao vi c chống nhiễu cho mạch điện tử, hệ thống có độ tin cậy cao đòi hỏi khả tự phục hồi sau có tác động nhiễu Đối với họ ... - Chống nhiễu trờng điện từ dùng phơng pháp vỏ bọc kim loại - Vi c sử dụng họ linh kiện theo dõi nguồn cấp hoạt động vi xử lý vào mạch reset làm tăng khả tự phục hồi sau có tác động nhiễu vi xử ... Công vi c thiết kế mạch in bố trí không gian khối chức khác mạch ảnh hởng đáng kể đến khả chông nhiễu nội - Sử dụng nguồn cấp ổn dịnh theo nguyên lý điều chế độ rộng xung nâng cao vi c chống nhiễu...
  • 8
  • 143
  • 1

SỬ DỤNG KỸ THUẬT PHÂN TỬ ĐỂ XÁC ĐỊNH NẤM docx

SỬ DỤNG KỸ THUẬT PHÂN TỬ ĐỂ XÁC ĐỊNH NẤM docx
... loài nấm xác định từ trước nhà phân loại học với kỹ phù hợp, Các sở liệu trình tự chuỗi ADN công cộng sử dụng nguồn thông tin quan trọng Các phương pháp sử dụng kỹ thuật ADN để xác định nấm bệnh ... cần xác định Tuy nhiên, tất phương pháp sử dụng dựa sở khớp thông tin loài nấm chưa biết với loài nấm xác định đặc điểm hình thái học từ tiêu mẫu Do việc xác định loài nấm phụ thuộc vào loài nấm ... bào khác, từ hệ sang hệ khác việc xác định thứ tự Nucleotite chuỗi gọi xác định trình tự ADN Phương pháp Có nhiều phương pháp sử dụng kỹ thuật ADN để xác định nấm lựa chọn phương pháp phù hợp...
  • 7
  • 97
  • 0

Luận văn : Sử dụng kỹ thuật multiplex – PCR để phát hiện đồng thời các gen độc: stx1, stx2, eae, ehxA, và uid của E. coli part 5 doc

Luận văn : Sử dụng kỹ thuật multiplex – PCR để phát hiện đồng thời các gen độc: stx1, stx2, eae, ehxA, và uid của E. coli part 5 doc
... Escherichia coli O 157 :H7 increases survival in acidic foods Appl Environ Microbiol 6 1: 3 752 - 3 755 35 Lingwood C A 1996 Role of verotoxin receptors in pathogenesis Trends Microbiol 4: 147 - 153 36 ... hemorrhagic colitis caused by Escherichia coli O 157 :H7 and Shigella sonnei N Engl J Med 33 1: 57 9 - 58 4 29 Keskimaki M., 2001 Shiga toxin-producing and other diarrhoeagenic Escherichia coli in Finland: ... Shiga-like toxins in the pathogenesis of infection caused by enterohemorrhagic Escherichia coli O 157 :H7 in gnotobiotic piglets Infect Immun 5 5: 3117 - 31 25 49 USA Department of Agriculture’s Food...
  • 7
  • 148
  • 0

Luận văn : Sử dụng kỹ thuật multiplex – PCR để phát hiện đồng thời các gen độc: stx1, stx2, eae, ehxA, và uid của E. coli part 4 ppsx

Luận văn : Sử dụng kỹ thuật multiplex – PCR để phát hiện đồng thời các gen độc: stx1, stx2, eae, ehxA, và uid của E. coli part 4 ppsx
... mặt thịt bò, kết phát gen độc lực E coli từ mẫu khảo sát tổng hợp bảng 4. 6 Như vậy, 36 mẫu khảo sát có 16 mẫu phát E coli mang gen độc lực nhóm STEC, chiếm tỉ lệ 44 ,4% Gen ehxA phát với tỉ lệ cao ... chảy Gen độc lực uid Thịt bò Biểu đồ 4. 1 Kết phát gen độc lực E coli 36 mẫu khảo sát 33 Hình 4. 1 Kết điện di sản phẩm multiplex - PCR T 1: mẫu thịt số 1; P.B 1: mẫu phân bò tiêu chảy số 1; Ladder: ... l : 50%; 44 ,4% 100% (4) mẫu bề mặt thịt bò chưa phát gen độc lực E coli (5) Chưa phát gen uid eae 27 mẫu phân tiêu chảy bò, bê heo; mẫu bề mặt thịt 5.2 Tồn đề nghị  Tồn Do điều kiện thời gian...
  • 9
  • 118
  • 0

Luận văn : Sử dụng kỹ thuật multiplex – PCR để phát hiện đồng thời các gen độc: stx1, stx2, eae, ehxA, và uid của E. coli part 3 pdf

Luận văn : Sử dụng kỹ thuật multiplex – PCR để phát hiện đồng thời các gen độc: stx1, stx2, eae, ehxA, và uid của E. coli part 3 pdf
... Multiplex - PCR Loại bỏ ống NA giữ gốc (+) ) Ly trích DNA riêng theo ống NA Multiplex- PCR Sơ đồ 3. 1 Qui trình phân lập, định tính phát gen độc lực E coli 22 3. 3.4 Qui trình multiplex PCR (1) Trình ... Trình tự đoạn mồi sử dụng multiplex PCR Bảng 3. 1 Trình tự đoạn mồi sử dụng phản ứng multiplex - PCR Kích cỡ DNA Mồi (primer) Trình tự oligonucleotide (5’ 3 ) khuếch đại (bp) Eae F ATTACCATCCACACAGACGGT ... SMAC, multiplex PCR phát 100% E coli mang gen ehxA gen stx Tóm lại, nhóm khuẩn lạc (gồm 10 khuẩn lạc) có mang gen độc lực chưa khuẩn lạc riêng lẻ mang gen độc lực Cho nên chọn khuẩn lạc để nghiên...
  • 9
  • 185
  • 0

Luận văn : Sử dụng kỹ thuật multiplex – PCR để phát hiện đồng thời các gen độc: stx1, stx2, eae, ehxA, và uid của E. coli part 2 ppsx

Luận văn : Sử dụng kỹ thuật multiplex – PCR để phát hiện đồng thời các gen độc: stx1, stx2, eae, ehxA, và uid của E. coli part 2 ppsx
... E coli phân bò, heo bề mặt thịt bò - Li trích DNA E coli phân lập - Thực phản ứng multiplex PCR để phát gen eae, ehxA, stx1, stx2 uid E coli 3.3 Phương pháp thực 3.3.1 Vật liệu thí nghiệm Dụng ... (thang chuẩn) 2. 4.5 Multiplex PCR Là phản ứng PCR sử dụng đồng thời nhiều cặp mồi để khuếch đại nhiều đoạn DNA phản ứng PCR Phương pháp thử nghiệm thành công vào năm 1988 áp dụng vào nhiều công ... thú y, PCR sử dụng để chẩn đoán mầm bệnh virus, vi khuẩn, protozoa lẫn ký sinh trùng đa bào Trong nông nghiệp công nghiệp thực phẩm, sử dụng PCR để phát gen halothan, gen thụ thể estrogen, gen thụ...
  • 9
  • 98
  • 0

Sử dụng kỹ thuật diffserv MPLS để đánh giá chất lượng dịch vụ IPTV luận văn thạc sĩ

Sử dụng kỹ thuật diffserv   MPLS để đánh giá chất lượng dịch vụ IPTV luận văn thạc sĩ
... experiments, DiffServ - MPLS technique The Combining packets and have good at exploitation DiffServ my thesis show the advantages and MPLS improve the quality of and management the network DiffServ - MPLS ... 38 3.3.2.9 Kich ban 8: High_ Video _DiffServ 38 3.3.2.10 Kich ban 9: High_ Video _DiffServ_ MPLS 39 3.3.2.11 Luu d6 rno phong mang Baseline, DiffServ, DiffServ _ MPLS 40 V III Luan van t6t nghiep ... Chuyen mach nhan da giao thirc MPLS Kh'" nl~m al ·A /,~ ;' /i'! • • • 20 20 2.3.2 Ki~n true MPLS 20 2.3.3 Ki~n true mi~n MPLS 20 2.3.4 MPLS Header (Tieu d~ nhan MPLS) 21 2.3.5 Duong chuyen...
  • 13
  • 111
  • 0

sử dụng kỹ thuật pcr -rflp để phát hiện đột biến kháng lamivudine và đột biến basal core promter của virus viêm gan b

sử dụng kỹ thuật pcr -rflp để phát hiện đột biến kháng lamivudine và đột biến basal core promter của virus viêm gan b
... điều trò Một số b nh nhân có mang HBV đột < /b> biến < /b> – liên quan đến giảm biểu HBeAg, kiểu đột < /b> biến < /b> sau: - Đột biến < /b> Basal < /b> core < /b> promoter: đột < /b> biến < /b> kép A1762T/ G1764A - Đột biến < /b> Precore: đột < /b> biến < /b> G1896A, ... promoter đột < /b> biến < /b> kháng < /b> lamivudine < /b> giúp ích cho việc theo dõi điều trò b nh viêm < /b> gan < /b> B Nested PCR-< /b> RFLP kỹ < /b> thuật < /b> đơn giản tiện ích để < /b> xác đònh đột < /b> biến < /b> Basal < /b> core < /b> promoter đột < /b> biến < /b> kháng < /b> lamivudine < /b> ... Sequencing phát < /b> trường hợp hỗn hợp hoang dại đột < /b> biến < /b> Nested PCR-< /b> RFLP kỹ < /b> thuật < /b> đơn giản tiện ích để < /b> xác đònh đột < /b> biến < /b> Basal < /b> core < /b> promoter đột < /b> biến < /b> kháng < /b> lamivudine < /b> Hiện < /b> giới có nhóm kỹ < /b> thuật < /b> dùng để < /b> phát...
  • 75
  • 61
  • 0

Sử dụng kỹ thuật MC-CDMA để loại bỏ nhiễu đa người dùng (MUI) trong thông tin di động

Sử dụng kỹ thuật MC-CDMA để loại bỏ nhiễu đa người dùng (MUI) trong thông tin di động
... tài: Sử dụng kỹ thuật MC-CDMA để loại bỏ nhiễu đa người dùng (MUI) thơng tin di động Nội dung Trong đồ án đề cập cách tổng quan kỹ thuật MC-CDMA nêu lên ưu điểm, nhược điểm kỹ thuật MC-CDMA Trình ... người sử dụng tế bào gán mã (code) đặc biệt khơng có hai người sử dụng tế bào có mã (có nghĩa người có mã riêng biệt) Máy thu vào mã người sử dụng để khử bớt (khơng thể khử hết) nhiễu người sử dụng ... MC-CDMA cho hệ thống thơng tin di động tương lai Chính vậy, việc tìm hiểu kỹ thuật MC-CDMA để loại bỏ nhiễu cần thiết có ý nghĩa thực tế Xuất phát từ suy nghĩ trên, em định chọn đề tài: Sử dụng...
  • 67
  • 190
  • 1

Sử dụng kỹ thuật diffserv MPLS để đánh giá chất lượng dịch vụ IPTV

Sử dụng kỹ thuật diffserv   MPLS để đánh giá chất lượng dịch vụ IPTV
... T T Đề tài Sử dụng kỹ thuật DiffServ MPLS để đánh giá chất l ợng dịch vụ IPTV đư đ ợc thực từ tháng 02 năm 2012 đến tháng 08 năm 2012 tr ng Đại Học S Phạm Kỹ Thuật TP Hồ Chí Minh IPTV- Truyền ... mạng, loại dịch vụ Best - Effort, dịch vụ Intserv, dịch vụ Diffserv, chuyển mạch gói IP, chuyển mạch nhưn đa giao th c MPLS, thuật toán ng dụng cho dịch vụ, toán mô chất l ợng dịch vụ IPTV[ 20] ... ợng chuyển tiếp gói tin: Áp dụng kỹ thuật DiffServ để phân loại gói tin theo m c chất l ợng dịch vụ, kết hợp với kỹ thuật MPLS để chuyển tiếp gói tin, từ đánh giá chất l ợng gói tin thông qua...
  • 147
  • 92
  • 0

Sử dụng kỹ thuật DiffServ–MPLS để đánh giá chất lượng dịch vụ IPTV

Sử dụng kỹ thuật DiffServ–MPLS để đánh giá chất lượng dịch vụ IPTV
... BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC SƯ PHẠM KỸ THUẬT THÀNH PHỐ HỒ CHÍ MINH LUẬN VĂN THẠC SĨ LÂM ĐẠO TƯỜNG SỬ DỤNG KỸ THUẬT DIFFSERV - MPLS ĐỂ ĐÁNH GIÁ CHẤT LƯỢNG DỊCH VỤ IPTV NGÀNH: KỸ THUẬT ... BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC SƯ PHẠM KỸ THUẬT THÀNH PHỐ HỒ CHÍ MINH LUẬN VĂN THẠC SĨ LÂM ĐẠO TƯỜNG SỬ DỤNG KỸ THUẬT DIFFSERV - MPLS ĐỂ ĐÁNH GIÁ CHẤT LƯỢNG DỊCH VỤ IPTV NGÀNH: KỸ THUẬT ... đảm bảo chất lượng dịch vụ - QoS lý chọn lựa thực đề tài Sử dụng kỹ thuật DiffServ MPLS để đánh giá chất lượng dịch vụ IPTV Trên tảng báo[6][7][8][9][10] [11][12] triển khai mở rộng để thực...
  • 22
  • 50
  • 0

Giáo trình phân tích và sử dụng kỹ thuật sấy trong quá trình bảo quản phần 1 ppt

Giáo trình phân tích và sử dụng kỹ thuật sấy trong quá trình bảo quản phần 1 ppt
... I KỸ THUẬT SẤY VÀ LÀM KHÔ NÔNG SẢN 1. 1 CƠ SỞ KHOA HỌC CỦA QUÁ TRÌNH SẤY KHÔ NÔNG SẢN Hầu hết sản phẩm nông nghiệp để bảo quản lâu dài cần phải thông qua trình phơi sấy, để làm khô tới thuỷ phần ... Ch.nước 10 00 C = Ck + d Ch.nước 10 00 (1. 6) (1. 7) (1. 8) Trong đó: C nhiệt dung không khí ẩm Ck nhiệt dung riêng không khí khô Cn nhiệt dung riêng nước Đơn vị C J/kg.oC 1. 1.2 Bản chất trình sấy Sấy trình ... sấy không đổi Quá trình sấy phân thành hai giai đoạn: giai đoạn sấy với tốc độ không đổi(nhiệt độ vật sấy không đổi) giai đoạn sấy với tốc độ sấy giảm dần(nhiệt độ vật sấy tăng dần) Để phân tích...
  • 10
  • 120
  • 0

Giáo trình phân tích và sử dụng kỹ thuật sấy trong quá trình bảo quản phần 2 pdf

Giáo trình phân tích và sử dụng kỹ thuật sấy trong quá trình bảo quản phần 2 pdf
... tốc độ gió hỗn hợp dòng khí đo cảm biến tương ứng S2, S1, So 2. 2 CÁC PHẦN TỬ TRONG HỆ THỐNG THÍ NGHIỆM SẤY 2. 2.1 Cấu tạo, chức năng, yêu cầu kỹ thuật + Buồng trộn Kích thước 700x800x700 ép xốp ... trình thí nghiệm sấy để khảo sát diễn biến Mô hình vật lý trình thí nghiệm sấy nông sản mô tả Hình 2. 1 Hình 2. 1 Sơ đồ mô hình thí nghiệm trình sấy Ở mô hình xây dựng này, để điều khiển toàn trình ... sau sấy chưa đủ Mà với lượng sản phẩm sấy lớn thời gian dài lâu đòi hỏi đặt cho ngành công nghệ sấy chi phí lượng thực trình sấy Thật giả sử có hai loại nông sản sấy chế độ cho sản phẩm đảm bảo...
  • 10
  • 134
  • 1

Giáo trình phân tích và sử dụng kỹ thuật sấy trong quá trình bảo quản phần 3 pot

Giáo trình phân tích và sử dụng kỹ thuật sấy trong quá trình bảo quản phần 3 pot
... khí kỹ thuật sấy người ta gọi sấy ε Như vậy, sấy bằng: ε = t k - tư (2.11) + Tính toán phân áp suất bão hoà theo nhiệt độ Để xác định độ ẩm tương đối không khí ẩm, trước hết cần xác định phân ... (2 .30 ) Trong dsc tiết diện bị cắt khoảng thời gian dt, Bj thành phần ur B vuông góc với dsc Tiết diện bị cắt tính tích số: dsc = l.v.dt (2 .31 ) với l chiều dài dây dẫn v vận tốc dài v = ω.r (2 .31 ) ... pa) 1,0 13 p (2.21) Thay công thức (2.18), (2.19), (2.20) (2.21) vào công thức (2.17) ta được: p m – pa = α p.(tk – tư) = A.p.(tk - tư) αm.1,0 13. r - 26 - (2.22) Trong đó: A= α αm.1.0 13. r Hệ số...
  • 10
  • 147
  • 0

Giáo trình phân tích và sử dụng kỹ thuật sấy trong quá trình bảo quản phần 4 pps

Giáo trình phân tích và sử dụng kỹ thuật sấy trong quá trình bảo quản phần 4 pps
... - Một ICLM3 24 IC khuyếch đại thuật toán bao gồm mạch so sánh Hình 2.5 Sử dụng để so sánh tín hiệu đặt đầu vào không đảo tín hiệu đo từ cảm biến đặt vào đầu đảo 14 13 12 11 10 GND 4+ +3 1+ +2 ... 2.7 Cấu tạo ICLM3 24 - Một IC74HC 04 IC gồm cổng NOT mục đích việc đưa thêm cổng NOT vào để tăng tính ổn định đồng thời thuận lợi cho việc đưa tín hiệu vào vi xử lí Ngoài sử dụng số linh kiện khác ... đối diện phần phát tia hồng ngoại phản xạ đến phần thu Lúc tính chất cấu tạo phần thu có ánh sáng hồng ngoại chiếu vào điện trở giảm xuống nhanh giảm phụ thuộc vào cường độ phản xạ phần phát...
  • 10
  • 158
  • 0

Xem thêm

Từ khóa: ứng dụng kỹ thuật multiplex – pcr để phát hiện các gen độc lực của vi khuẩn escherichia coli phân lập từ phân bò phân heo tiêu chảy và thịt bòluận văn ứng dụng kỹ thuật multiplex – pcr để phát hiện các gen độc lực của vi khuẩn escherichia coli phân lập từ phân bò phân heo tiêu chảy và thịt bò part 6 docsử dụng kỹ thuật pcr cho xác định typ vi sinh vậtxét lại những tác động của chính sách tài khóa lên tổng thể kinh tế vĩ mô một sự phân tích tách biệt sử dụng kỹ thuật svarnckhspud sử dụng kỹ thuật đặt câu hỏi để nâng cao chất lượng dạy học phần một số vấn đề của châu lục và khu vực trong chương trình địa lí lớp 11 thptứng dụng kỹ thuật vi ghép trong nhân giốngcác bước cơ bản xử lý nguyên liệu để nhận được đường hoà tan sử dụng men hoặc vi khuẩn để biến đổi đường thành ethanol và co2mạng hsdpa sử dụng kỹ thuật chuyển giaochữ ký điện tử sử dụng kỹ thuậtsử dụng ký thuậtung thư biểu mô khoang miệng có sử dụng kỹ thuật tạo hình bằng vạt rãnh mũi másử dụng kỹ thuật mdsmạng hsdpa sử dụng kỹ thuật chuyển giao nàohệ thống wcdma sử dụng kỹ thuật trải phổhệ thống wcdma sử dụng kỹ thuật trải phổ nàoGiao trinh bai tap routh hurwitzGiao trinh bai tap heat transfer+by+holman+6th+edGiao trinh bai tap c6 ql sd hieu qua nl y1313 s2 pumpfanGiao trinh bai tap tcvn 5687 1992Giao trinh bai tap bai tap vat lieu xay dung part 7Giao trinh bai tap bg02 c2 rock deformationGiao trinh bai tap cơ lưu chất 6Giao trinh bai tap đề thi cuối kì có đáp án (tham khảo)Hoàn thiện hoạt động dự thầu quốc tế về xây lắp tại công ty cổ phần đầu tư xây dựng linh giangGiao trinh bai tap báo cáo mẫu matlab giải tích 1Giao trinh bai tap fuzzy logic toolbox for use with matlabGiao trinh bai tap đề cuối kỳ 2014 2015 ca 2Giao trinh bai tap bdnldc baigiang1Giao trinh bai tap các bước vẽ của bt 07Giao trinh bai tap ch2 5786Giao trinh bai tap ktlt june2015 solGiao trinh bai tap ch6 bo nguon dc pptGiao trinh bai tap nhom 14Giao trinh bai tap fly ash based geopolymer concrete 2011Giao trinh bai tap bai 1 do luong 1 tai 3 pha
Đăng ký
Đăng nhập