0
  1. Trang chủ >
  2. Thạc sĩ - Cao học >
  3. Khoa học xã hội >

Luận văn a comparative study of discourse structures and linguistic features between information communication technology news in english and vietnamese

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

... LINGUISTIC FEATURES OF THE INTERNATIONAL CONVENTION ON HUMAN RIGHTS IN COMPARISON WITH THOSE OF THE INTERNATIONAL DECLARATION 4.1 Definition of an International Convention 4 .2 20 Purposes and typical ... Preamble of the Convention and their realization 4.3.1 21 23 The Body 23 4.3 .2. 1 The Body of the Convention and its realization 23 4.3 .2. 2 Remarks 26 a, Use of Grammar 26 a1 Modality 26 a2 Use of Active/ ... legal characteristics of the International Convention on Human Rights 20 4 .2. 1 Purposes 20 4 .2. 2 Typical legal characteristics 20 4.3 A study of discourse structure and some major linguistic features...
  • 6
  • 634
  • 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part  3

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3

... differences between international Declarations and Conventions 32 in terms of discourse structures and major linguistic features International Declarations and International Conventions are legal documents, ... Convention 4 .3 A STUDY OF THE DISCOURSE STRUCTURE AND MAJOR LINGUISTIC FEATURES OF INTERNATIONAL CONVENTIONS ON HUMAN RIGHTS IN COMPARISON WITH THOSE OF INTERNATIONAL DECLARATIONS ON HUMAN RIGHTS ... THE INTERNATIONAL DECLARATION ON HUMAN RIGHTS 10 3. 1 DEFINITION OF AN INTERNATIONAL DECLARATION 'International Declaration' generally is defined as "a formal statement agreed on or used by all...
  • 41
  • 839
  • 3
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part  4

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4

... spirit of article 29; (b) Encourage international co-operation in the production, exchange and dissemination of such information and material from a diversity of cultural, national and international ... education accessible to all on the basis of capacity by every appropriate means; (d) Make educational and vocational information and guidance available and accessible to all children; (e) Take ... Civil and Political Rights (in particular in articles 23 and 24) , in the International Covenant on Economic, Social and Cultural Rights (in particular in article 10) and in the statutes and relevant...
  • 28
  • 611
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Indirect-HMM-based Hypothesis Alignment for Combining Outputs from Machine Translation Systems In Proceeding of EMNLP Hawaii, US, Oct F Huang and K Papinent 2007 Hierarchical System Combination for Machine Translation ... word alignments are ready, we start from the intersection of the two word alignments, and then continuously add new links between backbone and hypothesis if and only if both of the two words of ... the hypothesis is assigned with a rank-based score of 1/ (1 + r ) , where r is the rank of the hypothesis And we assign the same weights to each system For selecting the backbone, only the top hypothesis...
  • 8
  • 546
  • 1
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... TATATCATATGTCTATCTACGACTTCAAGGTC ATATAGGATCCTCACGATTGAGTGCTTGG ATATATCATATGTCCGGTGTCGCAAAG ATATAGGATCCTTACTCGTCTCTCCACGG ATATATCATATGTCCTGCGGTAACGCC ATATAGGATCCTTACTGCTTGCTGAAGTATC CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCG ... Heterologous priming-boosting with DNA and modied vaccinia virus Ankara expressing tryparedoxin peroxidase promotes long-term memory against Leishmania major in susceptible BALB c mice Infect Immun 75, ... min) and protein content in the supernatants determined by the Bradford protein assay (Bio-Rad) using BSA as standard L major protein extracts Comparison of L major tryparedoxin peroxidases in...
  • 16
  • 483
  • 0
báo cáo khoa học:

báo cáo khoa học: " Medical tourism and policy implications for health systems: a conceptual framework from a comparative study of Thailand, Singapore and Malaysia" pot

... Singapore, Thailand and Malaysia as the three main hubs for medical tourism in Southeast Asia for comparative analysis Broadly, there are four types of comparative health policy analyses The first ... decades This paper presents a conceptual framework (Figure 1) that identifies the policy implications of medical tourism for health systems, from a comparative analysis of Thailand, Singapore and ... and Social Science Research Network databases using the search criteria medical tourism AND Asia” (92) and medical travel AND Asia” (806), generating a range of mostly conceptual research Abstracts...
  • 12
  • 463
  • 0
A comparative study of the biological and physical properties of viscosity enhanced root repair material (VERRM) AND MTA

A comparative study of the biological and physical properties of viscosity enhanced root repair material (VERRM) AND MTA

... A COMPARATIVE STUDY OF THE BIOLOGICAL AND PHYSICAL PROPERTIES OF VISCOSITY ENHANCED ROOT REPAIR MATERIAL (VERRM) AND MTA PALLAVI UPPANGALA (BDS RGUHS, India) A THESIS SUBMITTED FOR THE DEGREE ... Maxillofacial Surgery, Faculty of Dentistry Thesis Title: A comparative study of the biological and physical properties of Viscosity Enhanced Root Repair Material (VERRM) and MTA Summary The emergence ... Standards (Wataha JC 1996) 2.3.2 Clinical applications of MTA Torabinejad and Chivian (1999), described the various uses of MTA in vital pulp therapy, repair of root perforations, and as a root- end...
  • 95
  • 778
  • 0
A comparative study of singapores chinatown and bangkoks chinatown

A comparative study of singapores chinatown and bangkoks chinatown

... Street) and Yaowarat; the shopkeepers conducting businesses in Pagoda and Trengganu Street and Yaowarat Road and Charoen Krung Road and members of the temple and foundation hospitals As this is a comparative ... 13 that a comparative analysis can offer us more insight into broader social changes that have taken place in the Singapore case and allow for a more nuanced and sensitive reading of Chinatown s ... day‟s labour is palpable and as the day draws to a close, that which permeates the air is a relaxed atmosphere 39 sidewalk rhythm20 that is part of urban land use in Thailand (Dovey and Polakit,...
  • 190
  • 584
  • 0
The issue of lesbianism in contemporary indian films  a comparative study of transnational, bollywood and regional film

The issue of lesbianism in contemporary indian films a comparative study of transnational, bollywood and regional film

... Contemporary Indian Films: A Comparative Study of Transnational, Bollywood and Regional Films Introduction Contemporary Indian cinema has undergone substantial changes over the last couple of decades ... in this thesis, The Journey, or Sancharram in Malayalam, is an example of a regional Indian film made in the Indian state of Kerala Malayalam movies are considered to be more realistic than Bollywood ... employed in the film because the gaze behind the camera is that of a female—specifically, that of an Indian lesbian Reena’s gaze behind the camera is an instance of re-appropriating the male gaze that...
  • 130
  • 833
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

... constructed a string-to -dependency translation platform for comparing non-isomorphic target dependency structures Specially, we proposed an algorithm for generating word-based dependency trees from ... evaluation In Proceedings of NTCIR-9, pages 579– 584 David Magerman 1995 Statistical decision-tree models for parsing In In Proceedings of of the 33rd Annual Meeting of the Association for Computational ... toolkit for statistical machine translation In Proceedings of the ACL 2007 Demo and Poster Sessions, pages 177–180 Jeff Ma and Spyros Matsoukas 2011 Bbn’s systems for the chinese-english sub-task of...
  • 5
  • 410
  • 0
Internationnal payment A case study of freight forwarding and logistics companies in Vietnam  Luận văn thạc sĩ

Internationnal payment A case study of freight forwarding and logistics companies in Vietnam Luận văn thạc sĩ

... remarkable advantages, forwarding and logistics companies can participate and perform very well the role of a key chain in international payments Settling via international freight forwarding and ... 4.2 Forwarding and logistics in international payment, in reality 34 As an international business, forwarding and logistics companies should operate their activities basing on a stable and extensive ... logistics, transportation, and supply chain management 4.3 Encroaching of forwarding and logistics companies in international payment Forwarding and logistics companies satisfy the necessary and sufficient...
  • 100
  • 677
  • 0
The chinese discourse marker suoyi  a comparative study of its usage between native speakers and singapore mandarin learners

The chinese discourse marker suoyi a comparative study of its usage between native speakers and singapore mandarin learners

... ——母语者和新加坡汉语学习者使用情况对比研究 THE CHINESE DISCOURSE MARKER "SUOYI" : A COMPARATIVE STUDY OF ITS USAGE BETWEEN NATIVE SPEAKERS AND SINGAPORE MANDARIN LEARNERS 王荣耀 WANG RONGYAO 新加坡国立大学中文系 硕士学位论文 A THESIS SUBMITTED FOR THE ... use the data forming the basis of my analysis as part of her project “Spoken Vocabulary of Singapore Mandarin Chinese: a Corpus-driven Approach” (The Ministry of Education of Singapore Academic ... 97 v Abstract Based on corpus, this study compares the Chinese discourse marker suoyi used by Singapore mandarin learners and Chinese native speakers, in terms of its function and frequency...
  • 123
  • 1,149
  • 0

Xem thêm

Từ khóa: a comparative study of parameter estimation methodsa comparative study of parameter estimation methods for statistical natural language processinga comparative study of british and vietnamese funeral ritualsa comparative study of social network modelsa comparative study of criticism between american and vietnamese online newspapersa comparative study of piperidinium and imidazolium based ionic liquids thermal spectroscopica comparative study of bosnian and romanian opiniona comparative study of glasgow and isfahan2 a comparative study of lexical cohesive devices through some english and vietnamese fablesa case study of tano odumasi and jachiethe concept of islamic international criminal law a comparative studya comparative study on generalization of semantic roles in framenetsummary a comparative study on invitations in english and vietnamese in terms of crosscultural perspectiveb a thesis a comparative study on making requests in vietnamese and english in terms of politenessa philosophical study of moralityGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ