0

a comparative study of british and vietnamese funeral rituals

Báo cáo y học:

Báo cáo y học: "A comparative study of anxiety and depression in patients with bronchial asthma, chronic obstructive pulmonary disease and tuberculosis in a general hospital of chest diseases" ppsx

Báo cáo khoa học

... pulmonary disease.BioMed CentralPage 1 of 4(page number not for citation purposes)Annals of General PsychiatryOpen AccessPrimary research A comparative study of anxiety and depression in patients ... atselebis@yahoo.gr; Athanasios Karkanias - apkarkanias@gmail.com; Dimitra Stamouli - demistam@otenet.gr; Ioannis Ilias - iiliasmd@yahoo.com; Dionisios Bratis - dionbratis@yahoo.gr; Kalliopi Vassila-Demi ... bronchial asthma, chronic obstructive pulmonary disease and tuberculosis in a general hospital of chest diseasesGeorgios Moussas*1, Athanasios Tselebis2, Athanasios Karkanias2, Dimitra Stamouli2,...
  • 4
  • 669
  • 0
A comparative study of criticism between american and vietnamese online newspapers

A comparative study of criticism between american and vietnamese online newspapers

Thạc sĩ - Cao học

... to view Americans as unemotional and cold. Meanwhile, it is believed that Americans are much more direct than Asians, particularly Vietnamese. As a result, Vietnamese who appreciate and consider ... Vietnamnet)191 Chapter 1: INTRODUCTION1.1 RationaleLanguage and culture are interdependent and interactional. Culture affects the way language is used and language may reflect many factors of ... way of communicating in general and criticizing in particular. In addition, with the popularity of Internet and online magazines in English language, people have more chances to interact and...
  • 37
  • 756
  • 6
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 2

Thạc sĩ - Cao học

... STRUCTURE AND SOME MAJOR LINGUISTIC FEATURES OF THE INTERNATIONAL DECLARATION ON HUMAN RIGHTS3.1 Definition of an International Declaration 103.2 Purposes and typical legal characteristics of the ... Declaration and its realization 133.3.2.2 Remarks 14 a, Use of Grammar 14 a1 . Modality 14 a2 . Use of Active / Passive voices 14 a3 . Sentence order 15 a4 . Length of sentences 15 a5 . Kinds of sentences ... Convention and its realization 234.3.2.2 Remarks 26 a, Use of Grammar 26 a1 . Modality 26 a2 . Use of Active/ Passive voices 27 a3 . Sentence order 27 a4 . Length of sentences 27 a5 . Kinds of sentences...
  • 6
  • 634
  • 0
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part  3

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 3

Thạc sĩ - Cao học

... use and language learning, and is therefore of great importance to language teachers. Traditionally, language teaching has concentrated on pronunciation, grammar, and vocabulary, and while ... clause) is a group of words that has a subject and a verb. As it is a part of a sentence but grammatically independent, it could stand alone as a main clause. The writer try to take full advantage ... indirectly'; 'to and from'; 'at the time of ratification or at any time thereafter'; 'any Contracting State or any national of a Contracting State'. They are effective...
  • 41
  • 839
  • 3
A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part  4

A comparative study of discourse structures and some major linguistic features of international declarations and international conventions on human rights part 4

Thạc sĩ - Cao học

... pornographic performances and materials. Article 35States Parties shall take all appropriate national, bilateral and multilateral measures to prevent the abduction of, the sale of or traffic ... (d) Make educational and vocational information and guidance available and accessible to all children; (e) Take measures to encourage regular attendance at schools and the reduction of drop-out ... from all forms of sexual exploitation and sexual abuse. For these purposes, States Parties shall in particular take all appropriate national, bilateral and multilateral measures to prevent: (a) ...
  • 28
  • 611
  • 0
A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot

A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot

Sức khỏe giới tính

... Mycobacteria.Statistical analysisAs no single gold standard was available forcomparison of the performance of the individualtests, an analysis of results was done using a variety of standards. Efficiency of ... serial-c). These cases were as follows, two each of asthma, pneumonia and cancer lung, one each of post CABG, COPD and lung abscess and 12 withcough and cold. All samples from these individualshad ... Journal of Tuberculosis A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSISUSING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION*Original ArticleKavita Modi – Parekh 1, Vikas Inamdar...
  • 8
  • 524
  • 0
Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot

Báo cáo khoa học: Mechanisms of accumulation of arachidonate in phosphatidylinositol in yellowtail A comparative study of acylation systems of phospholipids in rat and the fish species Seriola quinqueradiata pot

Báo cáo khoa học

... Mechanisms of accumulation of arachidonate in phosphatidylinositolin yellowtail A comparative study of acylation systems of phospholipids in rat and the fishspeciesSeriola quinqueradiataTamotsu ... quinqueradiataTamotsu Tanaka, Dai Iwawaki, Masahiro Sakamoto, Yoshimichi Takai, Jun-ichi Morishige,Kaoru Murakami and Kiyoshi SatouchiDepartment of Applied Biological Science, Fukuyama University, JapanIt ... the large amounts of docosahexaenoic acid in yellowtailLipids from yellowtail have a preponderance of docosa-hexaenoic acid over arachidonic acid. In fact, docosahexa-enoic acid and arachidonic...
  • 8
  • 619
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học

... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong, Q. Liu and ... Ward, and W J. Zhu. 2002. BLEU: a method for automatic evaluation of machine translation. In Proceeding of ACL-2002, pp. 311-318. A. I. Rosti, N. F. Ayan, B. Xiang, S. Matsoukas, R. Schwartz...
  • 8
  • 546
  • 1
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học

... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTGF-TDPX1 Cys64Ala GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTCR-TDPX1 Cys64Ala GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1 Cys83Ala AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAGR-TDPX1 ... codons of the mutated amino acids are in bold.Cloned protein or mutation primer (5’- to 3’)F-TDPX1 TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX...
  • 16
  • 483
  • 0
party systems in post-soviet countries. a comparative study of political institutionalization in the baltic states, russia and ukraine. 2007

party systems in post-soviet countries. a comparative study of political institutionalization in the baltic states, russia and ukraine. 2007

Tổng hợp

... Sotsial-Demokratychna Partiya Ukrainy (Ob”ednana)(Social Democratic Party of Ukraine - United)UNA Ukrains’ka Natsional’na Asambleya (Ukrainian NationalAssembly)UNSO Ukrains’ka Natsional’na Samooborona ... leadingattributes of a party organization “which determine the capacity of parties tooperate in the electoral arena are: budget, professional staff, party officers and institutional support and candidate ... (1973)African party systems √√√√Panebianco (1988)√√European political partiesMainwaring and Scully (1996)Latin American party√√√√systemsRandall and Sväsand (2002)√√√√Parties and party...
  • 279
  • 751
  • 0
báo cáo hóa học:

báo cáo hóa học:" A Comparative Study of HIV/AIDS: The Knowledge, Attitudes, and Risk Behaviors of Schizophrenic and Diabetic Patients in Regard to HIV/AIDS in Nigeria" doc

Hóa học - Dầu khí

... emotionaldisorders in Nigerian women. A study of antecedents and association. Br J Psychiatry 1993, 163:645-650. Abstract14. Federal Ministry of Health: National HIV/AIDS and reproductivehealth ... 1992, 87:1663-1668. Abstract3. Morio S, Soda K, Tajima K, et al.: Sexual behaviour of commercialsex workers and their clients in Cambodia. Japan-CambodiaCollaborating Research Group. J Epidemiol ... their attitude and behaviortoward persons with the disease. The instrument includedsections on background characteristics, sexual behaviors, and condom use.Data AnalysesThe data were analyzed...
  • 6
  • 556
  • 0

Xem thêm

Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25