... pulmonary disease.BioMed CentralPage 1 of 4(page number not for citation purposes)Annals of General PsychiatryOpen AccessPrimary research A comparativestudyof anxiety and depression in patients ... atselebis@yahoo.gr; Athanasios Karkanias - apkarkanias@gmail.com; Dimitra Stamouli - demistam@otenet.gr; Ioannis Ilias - iiliasmd@yahoo.com; Dionisios Bratis - dionbratis@yahoo.gr; Kalliopi Vassila-Demi ... bronchial asthma, chronic obstructive pulmonary disease and tuberculosis in a general hospital of chest diseasesGeorgios Moussas*1, Athanasios Tselebis2, Athanasios Karkanias2, Dimitra Stamouli2,...
... to view Americans as unemotional and cold. Meanwhile, it is believed that Americans are much more direct than Asians, particularly Vietnamese. As a result, Vietnamese who appreciate and consider ... Vietnamnet)191 Chapter 1: INTRODUCTION1.1 RationaleLanguage and culture are interdependent and interactional. Culture affects the way language is used and language may reflect many factors of ... way of communicating in general and criticizing in particular. In addition, with the popularity of Internet and online magazines in English language, people have more chances to interact and...
... STRUCTURE AND SOME MAJOR LINGUISTIC FEATURES OF THE INTERNATIONAL DECLARATION ON HUMAN RIGHTS3.1 Definition of an International Declaration 103.2 Purposes and typical legal characteristics of the ... Declaration and its realization 133.3.2.2 Remarks 14 a, Use of Grammar 14 a1 . Modality 14 a2 . Use of Active / Passive voices 14 a3 . Sentence order 15 a4 . Length of sentences 15 a5 . Kinds of sentences ... Convention and its realization 234.3.2.2 Remarks 26 a, Use of Grammar 26 a1 . Modality 26 a2 . Use of Active/ Passive voices 27 a3 . Sentence order 27 a4 . Length of sentences 27 a5 . Kinds of sentences...
... use and language learning, and is therefore of great importance to language teachers. Traditionally, language teaching has concentrated on pronunciation, grammar, and vocabulary, and while ... clause) is a group of words that has a subject and a verb. As it is a part ofa sentence but grammatically independent, it could stand alone as a main clause. The writer try to take full advantage ... indirectly'; 'to and from'; 'at the time of ratification or at any time thereafter'; 'any Contracting State or any national ofa Contracting State'. They are effective...
... pornographic performances and materials. Article 35States Parties shall take all appropriate national, bilateral and multilateral measures to prevent the abduction of, the sale of or traffic ... (d) Make educational and vocational information and guidance available and accessible to all children; (e) Take measures to encourage regular attendance at schools and the reduction of drop-out ... from all forms of sexual exploitation and sexual abuse. For these purposes, States Parties shall in particular take all appropriate national, bilateral and multilateral measures to prevent: (a) ...
... Mycobacteria.Statistical analysisAs no single gold standard was available forcomparison of the performance of the individualtests, an analysis of results was done using a variety of standards. Efficiency of ... serial-c). These cases were as follows, two each of asthma, pneumonia and cancer lung, one each of post CABG, COPD and lung abscess and 12 withcough and cold. All samples from these individualshad ... Journal of Tuberculosis A COMPARATIVESTUDYOF THE DIAGNOSIS OF PULMONARY TUBERCULOSISUSING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION*Original ArticleKavita Modi – Parekh 1, Vikas Inamdar...
... Mechanisms of accumulation of arachidonate in phosphatidylinositolin yellowtail A comparativestudyof acylation systems of phospholipids in rat and the fishspeciesSeriola quinqueradiataTamotsu ... quinqueradiataTamotsu Tanaka, Dai Iwawaki, Masahiro Sakamoto, Yoshimichi Takai, Jun-ichi Morishige,Kaoru Murakami and Kiyoshi SatouchiDepartment of Applied Biological Science, Fukuyama University, JapanIt ... the large amounts of docosahexaenoic acid in yellowtailLipids from yellowtail have a preponderance of docosa-hexaenoic acid over arachidonic acid. In fact, docosahexa-enoic acid and arachidonic...
... Micciulla, and J. Makhoul. 2006. Astudyof translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong, Q. Liu and ... Ward, and W J. Zhu. 2002. BLEU: a method for automatic evaluation of machine translation. In Proceeding of ACL-2002, pp. 311-318. A. I. Rosti, N. F. Ayan, B. Xiang, S. Matsoukas, R. Schwartz...
... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTGF-TDPX1 Cys64Ala GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTCR-TDPX1 Cys64Ala GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1 Cys83Ala AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAGR-TDPX1 ... codons of the mutated amino acids are in bold.Cloned protein or mutation primer (5’- to 3’)F-TDPX1 TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX...
... Sotsial-Demokratychna Partiya Ukrainy (Ob”ednana)(Social Democratic Party of Ukraine - United)UNA Ukrains’ka Natsional’na Asambleya (Ukrainian NationalAssembly)UNSO Ukrains’ka Natsional’na Samooborona ... leadingattributes ofa party organization “which determine the capacity of parties tooperate in the electoral arena are: budget, professional staff, party officers and institutional support and candidate ... (1973)African party systems √√√√Panebianco (1988)√√European political partiesMainwaring and Scully (1996)Latin American party√√√√systemsRandall and Sväsand (2002)√√√√Parties and party...
... emotionaldisorders in Nigerian women. Astudyof antecedents and association. Br J Psychiatry 1993, 163:645-650. Abstract14. Federal Ministry of Health: National HIV/AIDS and reproductivehealth ... 1992, 87:1663-1668. Abstract3. Morio S, Soda K, Tajima K, et al.: Sexual behaviour of commercialsex workers and their clients in Cambodia. Japan-CambodiaCollaborating Research Group. J Epidemiol ... their attitude and behaviortoward persons with the disease. The instrument includedsections on background characteristics, sexual behaviors, and condom use.Data AnalysesThe data were analyzed...