0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Toward synthesis of a macrocyclic hybrid aromatic pentamer

Toward synthesis of a macrocyclic hybrid aromatic pentamer

Toward synthesis of a macrocyclic hybrid aromatic pentamer

... TOWARD SYNTHESIS OF A MACROCYCLIC HYBRID AROMATIC PENTAMER SUN XIAONAN (M.Sc.) PKU A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF SCIENCE DEPARTMENT OF CHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE ... synthetic facility, high structural diversity and adaptability In this regard, the aim of this study was to design and synthesize a new class of cyclic pentamer with tunable cation-binding cavities and ... macrocycles (b) Macrocycles assembling anistropically into a tubular structure that acts as a transmembrane channel or pore in the hydrophobic environment of a lipd bilayer     A set of structurally well-defined...
  • 38
  • 209
  • 0
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

... 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed by circularization with DNA ligase ... The DNA fragment coding the scFvLH (10 pg) was amplified with 0.4 lM each of the primers s1: 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LATaq PCR ... E coli cell-free system with chaperones was nearly half of the synthesized protein, which was almost the same as in our case Therefore, the wheatgerm system might have a practical advantage over...
  • 7
  • 330
  • 0
facile hydrothermal route to the controlled synthesis of a - fe2o3 1 - d nanostructures

facile hydrothermal route to the controlled synthesis of a - fe2o3 1 - d nanostructures

... occurred immediately Then the mixture solution was transferred into a commercial stainless steel Tef- lon-lined autoclave of 50 mL capacity The autoclave was maintained at a temperature of 18 0°C ... water and absolute ethanol respectively, and finally dried in air at 60°C The XRD pattern of prepared powder sample was collected using a Rigaku D/ Max-2200PC X-ray diffractometer using CuKα radiation ... = 1 5 417 8 Å) and a graphite monochromator Transmission electron microscopy (TEM) Facile hydrothermal route to the controlled synthesis of α -Fe2O3 1- D nanostructures Figure (a, e) TEM images of...
  • 5
  • 519
  • 0
simple and rapid synthesis of a-fe2o3 nanowires under ambient conditions

simple and rapid synthesis of a-fe2o3 nanowires under ambient conditions

... Srivastava, A K; Nandedkar, R V Growth and characterization of alpha-Fe2O3 nanowires J Appl Phys 2007, 102, 054303 [14] Dong, W T.; Zhu, C S Use of ethylene oxide in the sol gel synthesis of alpha-Fe2O3 ... Material (ESM) In spite of intensive research into one-dimensional structures of metal oxides in particular and NWs in general, our understanding of the mechanisms of their formation and growth is still ... accumulated in the Fe3O4 and FeO layers and cannot directly affect the 377 Nano Res (2009) 2: 373 379 growth of the NWs Figure shows our understanding of the NW formation conditions and a suggested mechanism...
  • 7
  • 631
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A truly green synthesis of a-aminonitriles via Strecker reaction" pdf

... enantioselective Strecker reactions and analogous syntheses Chem Rev 103:2795–2827 doi:10.1021/cr020038p Arasappan A, Venkatraman S, Padilla AI, Wu W, Meng T, Jin Y, Wong J, Prongay A, Girijavallabhan V, ... GKS, Mathew T, Panja C, Alconcel S, Vaghoo H, Do C, Olah GA (2007) Gallium (III) triflate catalyzed efficient Strecker reaction of ketones and their fluorinated analogs Proc Nat Acad Sci USA 104:3703–3706 ... G, Zhao G, Wang J (2009) Strecker- type reaction catalyzed by carboxylic acids in aqueous media Synthesis 12:2035–2039 29 Ishitani H, Komiyama S, Hasegawa Y, Kobayashi S (2000) Catalytic asymmetric...
  • 5
  • 268
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc

... intermittent control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear ... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a Class of Uncertain Nonlinear System This ... paper, we deal with the exponential stabilization problem of a class of uncertain nonlinear systems by means of periodically intermittent control Based on Lyapunov function approach, several stability...
  • 13
  • 444
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp:"The relationship between vegetation management and the wood and pulping properties of a Eucalyptus hybrid clone" pdf

... with a mean annual rainfall and temperature of 1144 mm and 22 °C respectively The trial was located at an elevation of 45 m on an east facing slope Soil parent material is of aeolian origin and ... treatments for selected wood and pulping properties as well as between the groups of variates for each treatment A summary of the analysis of variance and treatment means for tree growth and the ... important indicator of pulpwood quality Canonical Variate Analysis (CVA), also known as linear discriminant analysis, was used to make comparisons between the groups of variates rather than between...
  • 8
  • 387
  • 0
báo cáo khoa học:

báo cáo khoa học: " Habituation to thaxtomin A in hybrid poplar cell suspensions provides enhanced and durable resistance to inhibitors of cellulose synthesis" potx

... than three years To investigate the genetic mechanisms that are involved in establishing and maintaining resistance to TA, we have performed a global transcriptional analysis in TAhabituated cells ... compared to a very faint staining in control cells, also suggesting the accumulation of more pectins in the cell walls of TA(-)hab cells (Additional file Fig S3) Habituation to inhibitors of cellulose ... beta-xylosidases, a beta-mannan endohydrolase, a polygalacturonase, a pectinesterase, two expansins and a lyase Expression data in TA(-)hab cells was compared to that of Arabidopsis IXBhab cells [32] using matching...
  • 16
  • 255
  • 0
Tài liệu Báo cáo

Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt

... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactcgagccg ... TATCCCGCAA 360 400 401 GAGCCCGGCA GTACCGGCAT AACCAAGCCT ATGCCTACAG 440 441 CATCCAGGGT TTG GACGGTGCCG AGGATGACGA TGAAGCGCCA 480 Fig Sequence of recombinant plasmid DNA containing TI gene fragment Expression...
  • 9
  • 497
  • 0
Tài liệu Management Information Systems A Synthesis of Transit Practice ppt

Tài liệu Management Information Systems A Synthesis of Transit Practice ppt

... Authority Atlanta, Georgia Metro-Dade Transit Agency Miami, Florida San Francisco Bay Area Rapid Transit District Oakland, California Metra (Metropolitan Rail) Chicago, Illinois MTA New York City Transit ... sophisticated applications in at least one of the four management and operational areas under consideration (i.e., administration, planning and operations, materials management, and advanced technology ... Transportation Research Board TRANSIT COOPERATIVE RESEARCH PROGRAM Synthesis of Transit Practice Management Information Systems ROGER BOLDT Consultant Kalona, Iowa Topic Panel RONALD E BOENAU,...
  • 86
  • 1,217
  • 0
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

... characterization of native a-conotoxins Analysis of neuronally active a-conotoxins using HPLC and MS, including identification of post-translational modifications Isolation and identification Standard procedures ... 2004 Characterization and synthesis of a-conotoxins (Eur J Biochem 271) 2299 Fig LC/MS analysis of crude venom from C geographus Example of experiment approach using LC/ES MS of crude extract of ... Synthetic strategies for the preparation of a-conotoxins vary between laboratories and often reflect different scientific Ó FEBS 2004 Characterization and synthesis of a-conotoxins (Eur J Biochem 271)...
  • 11
  • 554
  • 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... et al Staphylococcal nuclease refolding investigated Two point-mutated proteins, with a single base substitution of alanine for tryptophan (W14 0A) and alanine for lysine (K13 3A) , and two truncated ... both the wild-type protein and mutants E142O and K13 3A Thermal analysis of protein unfolding The DSC curves of the wild-type protein and the mutants K13 3A, E142O, W14 0A and W140O are shown in Fig ... Our CD and DSC data show that the W140 in SNase is the amino acid responsible for the stability of the whole protein However, in comparison with the wild-type protein, the mutant W14 0A retains significant...
  • 7
  • 551
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... One approach to increase the duration of PNA binding to DNA is to conjugate it to a DNAalkylating reagent so that the PNA becomes covalently bound to its target sequence To this a DNA alkylating ... molecular mass markers be further accumulated within the mitochondria due to the mitochondrial membrane potential [11] From the known plasma and mitochondrial membrane potentials and the cell and mitochondrial...
  • 10
  • 638
  • 0
Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt

Tài liệu Báo cáo Y học: Dinucleoside polyphosphates stimulate the primer independent synthesis of poly(A) catalyzed by yeast poly(A) polymerase ppt

... confirming the adenylylation of these compounds and the absence of synthesis of poly(A) by the E coli poly(A) polymerase, we did not observed adenylylation of guanosine, GDP or Gp4G by the yeast enzyme ... independent synthesis of poly(A) In order to understand why dinucleoside polyphosphates activated the primer independent synthesis of poly(A), the effect of 0.01 mM Gp4G or Ap4A on the synthesis of poly(A) ... Effect of diadenosine polyphosphates on poly(A) polymerase Previous experiments had shown that diadenosine polyphosphates also stimulated the synthesis of poly(A) catalyzed by yeast poly(A) polymerase...
  • 7
  • 475
  • 0

Xem thêm

Từ khóa: synthesis of a metabolite of fantofaronesynthesis of a l lna a l ribo configured lna3 synthesis of polyphosphazene silicate hybrid networksa general synthesis of macrocyclic ruthenium ii metal complexesthe synthesis of the modified tetrapyrrole known asd1haem requires several dedicated proteins which are coded for by a set of genes that are often found adjacent to the structural genethe code offers a synthesis of the requirementscreative language retrieval a robust hybrid of information retrieval and linguistic creativitya look toward synthesisa synthesis of hydrocarbonsspecial topic biological synthesis of aromatic rings phenylalanineirreversible addition reactions a general synthesis of alcoholsunderstanding self disclosure in chronic illness from a meta synthesis of qualitative research5 a synthesis of data and methods across scales to connect local policy decisions to regional environmental conditions the case of the cascadia scorecardreasoning with a hybrid of a visual display and mental imagerywork toward ownership of the issues and a long term commitment to competency improvementBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015