synthesis of a l lna a l ribo configured lna
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf
Ngày tải lên :
16/03/2014, 23:20
... researches, parallel production of many different proteins will be also needed A protein synthesis machine that can perform PCR, transcription and translation automatically with a highly parallel ... pEU-scFvLH by inverse PCR with the primers s2: 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ (the sequences for the biotin tag are underlined) followed ... The DNA fragment coding the scFvLH (10 pg) was amplified with 0.4 lM each of the primers s1: 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LATaq PCR...
- 7
- 330
- 0
facile hydrothermal route to the controlled synthesis of a - fe2o3 1 - d nanostructures
Ngày tải lên :
19/03/2014, 16:48
... occurred immediately Then the mixture solution was transferred into a commercial stainless steel Tef- lon-lined autoclave of 50 mL capacity The autoclave was maintained at a temperature of 180°C for ... areas of large amount of nanoparticles, one can see the intense diffraction rings of polycrystals, which indicates the formation of well-crystallized product According to the index calculation and ... stirring and shaking during heating and then was allowed to cool to ambient temperature naturally The products were collected by centrifugation, washed twice with distilled water and absolute ethanol...
- 5
- 519
- 0
simple and rapid synthesis of a-fe2o3 nanowires under ambient conditions
Ngày tải lên :
20/03/2014, 13:07
... Kuchibhatla, A S.; Karakoti, D B.; [20] Fu, Y Y.; Wang, R M.; Xu, J.; Chen, J.; Yan, Y.; Narlikar, A Seal, S One dimensional nanostructured materials Prog V Zhang, H Synthesis of large arrays of aligned ... Kursumovic, A. ; JefFerson, D ; MacManus-Driscoll, J L. ; [27] de Faria, D L A. ; Lopes, F N Heated goethite and Amaratunga, G A J Growth and process conditions of natural hematite: Can Raman spectroscopy ... superstructureα 2O3 nanowire -Fe [35] Chueh, Y L. ; Lai, M -W.; Liang, J -Q.; Chou, L -J.; and nanobelt arrays in reactive oxygen Plasma Small Wang Z L Systematic study of the growth of aligned 2008,...
- 7
- 631
- 0
Báo cáo hóa học: " A truly green synthesis of a-aminonitriles via Strecker reaction" pdf
Ngày tải lên :
20/06/2014, 22:20
... excellent yields (94-97%) For aliphatic amines such as benzyl amine, piperidine and morpholine relatively slower reaction rate was observed A plausible mechanism may follow a two-step pathway ... GKS, Mathew T, Panja C, Alconcel S, Vaghoo H, Do C, Olah GA (2007) Gallium (III) triflate catalyzed efficient Strecker reaction of ketones and their fluorinated analogs Proc Nat Acad Sci USA 104:3703–3706 ... reaction proceeded equally well irrespective of the nature of the carbonyl compounds (aliphatic, aromatic, heteroaromatic) or amines (aliphatic, heterocyclic, and aromatic) to afford the Table...
- 5
- 268
- 0
Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc
Ngày tải lên :
21/06/2014, 06:20
... by means of periodically intermittent control Based on Lyapunov function approach, several stability criteria have been given in terms of a set of linear matrix inequalities, and stabilization ... periodically intermittent control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a ... between and It is seen from Figure that the closed-loop system is exponentially stable Conclusions In this paper, we deal with the exponential stabilization problem of a class of uncertain nonlinear...
- 13
- 444
- 0
Toward synthesis of a macrocyclic hybrid aromatic pentamer
Ngày tải lên :
30/09/2015, 10:11
... Chemical structure of macrocycles (b) Macrocycles assembling anistropically into a tubular structure that acts as a transmembrane channel or pore in the hydrophobic environment of a lipd bilayer ... can see that all the pentamers are intramolecularly H-bonded and highly rigid The 2D packing of the single crystal of this pentamer b was examined by X-ray diffraction and we found that it was ... mathematically predicted densest all-pentagon packing lattice by c5-symmetric fluoropentamers13 Figure 1.2 Structures of a series of intramolecular H-bounded, highly rigid and structurally well-defined...
- 38
- 209
- 0
MicrowaveAssisted Fluorous Synthesis of a 1,4Benzodiazepine2,5dione Library
Ngày tải lên :
26/08/2016, 11:22
... Hospital Supporting Information Available LC/MS and HR-MS and 1H and 13C NMR data for selected intermediates and final products This material is available free of charge via the Internet at http://pubs.acs.org ... Journal of Combinatorial Chemistry, 2009 Vol 11, No Liu et al Scheme General Transformations for the Preparation of a Biaryl-Substituted BDZ Library Scheme Boc-Anthranilic Acids 1-Based Synthesis ... http://pubs.acs.org References and Notes (1) Anzini, M.; Braile, C.; Valenti, S.; Cappelli, A. ; Vomero, S.; Marinelli, L. ; Limongelli, V.; Novellino, E.; Betti, L. ; Giannaccini, G.; Lucacchini, A. ; Ghelardini,...
- 11
- 376
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
Ngày tải lên :
07/03/2014, 12:20
... The animal and plant l- gulonolactone oxidoreductases are also active towards the l- galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes ... Arabidopsis thaliana L- galactono-1,4-lactone dehydrogenase (GLDH), At3g47930; Arabidopsis thaliana putative L- gulono-1,4-lactone dehydrogenase, At2g46740; Sus scrofa L- gulono-1,4-lactone oxidase ... determination of l- ascorbic acid and guanosine 5¢-diphosphate -l- galactose, key metabolites of the plant vitamin C pathway Anal Biochem 294, 161–168 52 Conklin PL, Pallanca JE, Last RL & Smirnoff...
- 11
- 571
- 0
Tài liệu Báo cáo khoa học: Characterization of a chemosensory protein (ASP3c) from honeybee (Apis mellifera L.) as a brood pheromone carrier pdf
Ngày tải lên :
21/02/2014, 03:20
... Nomura, A. , Kawasaki, K., Kubo, T & Natori, S (1992) Purification and localization of p10, a novel protein that increases in nymphal regenerating legs of Periplaneta americana (American cockroach) ... cDNA sequence with that of the N-terminal sequence of the natural ASP3c protein [20] showed that a 21-residue N-terminal signal sequence is cleaved after translation The average molar mass calculated ... Pichia pastoris Lane shows standards (Low range and Polypeptide kits, Bio-Rad, France) and lanes 2–5 are 50-lL aliquots of 0–3-days culture supernatants Proteins were visualized by Serva blue...
- 11
- 642
- 0
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx
Ngày tải lên :
22/02/2014, 04:20
... 5¢-TCAGCGTCACCGTTATCCTC-3¢ 5¢-GTGAGAAATGGAGATGCTGC-3¢ 5¢-TGTTCCGGAGAGCCTCCTC-3¢ 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢ 5¢-CACCGCATGCATAACTCTAGCTCCTTCTCTTG-3¢ 5¢-GTAAAACGACGGCCAGT-3¢ Ó FEBS 2002 4-Coumarate:CoA ligase ... 5¢-TCYGGRTCRTTNAGRTADCCTTTCAT-3¢ 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢ 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢ 5¢-AGTTTCAGGGTCAACAACCCTG-3¢ 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢ 5¢-CTCGGATCCATGGCTGATGATGGAAGCAG-3¢ 5¢-TCAGCGTCACCGTTATCCTC-3¢ ... cDNA [20] Fusion of partial Gm4CL3 cDNA and 5¢-end fragment amplified by PCR Full-length Gm4CL3 cDNA Full-length Gm4CL3 cDNA Partial Gm4CL4 cDNA [20] Fusion of partial Gm4CL4 cDNA and 5¢-end fragment...
- 12
- 448
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
Ngày tải lên :
07/03/2014, 16:20
... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 ... CLAP_1:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT CLAP_2:ATTTAAAAGAATTCCCGAATGGGCCAAGGATCTTCCATTGAAAGAAGTTTTGAGGTATCACATTGCAAGAGGGTTGTATTATGATAAAGATCTCCAGAAT...
- 12
- 772
- 0
Báo cáo khoa học: Purification and properties of a new S-adenosyl-Lmethionine:flavonoid 4¢-O-methyltransferase from carnation (Dianthus caryophyllus L.) pot
Ngày tải lên :
08/03/2014, 08:20
... DEAE-Cellulose (diethylaminoethyl-cellulose) (Whatman) packed and equilibrated with the buffer A; the elution was performed with 200 mL of a 0–0.5 M linear gradient of NaCl in buffer A, at a ... 3, and acetonitrile (6 : 1, v/v); separation was performed isocratically, at a flow rate of mLÆmin)1, and the volume of injected samples was 10 lL The amounts of the residual initial phenolic ... [12], plus 50 mg L) 1 ascorbic acid, 30 g L) 1 sucrose, lmol L) 1 2,4-dichlorophenoxyacetic acid, lmol L) 1 3-indolylacetic acid (IAA), 0.2 lmol L) 1 benzylaminopurine, 8.0 g L) 1 Difco Bacto agar, pH...
- 10
- 624
- 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
Ngày tải lên :
16/03/2014, 14:20
... acids, including l- aspartate, l- glutamine, l- alanine, l- arginine, l- cysteine, l- proline, l- phenylalanine, l- lysine, l- tryptophan, l- isoleucine, l- tyrosine, l- histidine, l- leucine, l- valine, l- methionine, ... reaction was analyzed using primary alcohols (methanol to dodecanol, C1–C12), secondary alcohols (propan-2-ol to decan-2-ol, C3–C10), alcohols containing more than one hydroxy group and l- amino ... SDS ⁄ PAGE reveals a molecular subunit mass of 40 kDa, which is in fair agreement with the molecular mass (38 kDa) calculated from the amino-acid sequence The molecular mass of the native Pf-TDH...
- 8
- 415
- 0
Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx
Ngày tải lên :
22/03/2014, 11:20
... outputs of port and port But now look closer at the scattering matrix We also note that the ports and of this device are matched It looks a lot like a lossless 3dB divider, only with an additional ... amplifying coefficient even more We have also investigated the S11 factor of the power divider Wilkinson on network analyzer, the result was relatively similar to that of the simulink model Afterthat ... fabricated the 200W amplifier modules from the smaller ones The basic modules were designed by using the microtrip technology [4], which are small and portable (figure 4a) After simulink modelling,...
- 5
- 374
- 0
Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt
Ngày tải lên :
23/03/2014, 10:21
... and to 3.85 min)1 and KM values of 1250 lm and 850 lm for BApNA and GPpNA, respectively, by means of standard LineweaverBurk analysis of initial rate kinetics Fitting of the experimental data ... Ramachandran Plot for the 20 deposited structures Table S1 Experimental vicinal coupling constants and calculated values for the most representative structure This material is available as part ... structures derived from restrained simulated annealing calculations Ca atoms only are displayed Table Conformational parameters for the 1521 and 2147 regions of LCTI Averaged /,w-values derived from the...
- 16
- 518
- 0
a path with heart - a guide through the perils and promises of spiritual l- jack kornfield
Ngày tải lên :
11/06/2014, 12:01
... undertook a year-long silent retreat in one room, sitting and walking for twenty hours a day I was offered excellent teachings in great monasteries led by Mahasi Sayadaw, Asabha Sayadaw, and Achaan ... path Several years ago I was called to visit a man in a San Francisco hospital by his sister He was in his late thirties and already rich He had a construction company, a sailboat, a ranch, a ... awareness of its dance As you sit, reflect on the benefit of balance and peace in your life Sense your capacity to rest unshakably as the seasons of life change All that arises will pass away Reflect...
- 250
- 467
- 0
Báo cáo hóa học: " Research Article Convergence Analysis of a Mixed Controlled l2 − l p Adaptive Algorithm" potx
Ngày tải lên :
21/06/2014, 08:20
... Unfortunately, a small value of the step size will make the algorithm converge very slowly, and a large value of the controlling parameter will make the LMS algorithm essentially dominant The rest of ... than one This makes the algorithm go unstable unless either a small value of the step size or a large value of the controlling parameter is chosen such that this unwanted instability is eliminated ... proposed algorithm is detailed The following assumptions which are quite similar to what is usually assumed in literature and which can also be justified in several practical instances are used...
- 10
- 426
- 0
Báo cáo hóa học: " Research Article Some Results for a Finite Family of Uniformly L-Lipschitzian Mappings in Banach Spaces" pdf
Ngày tải lên :
22/06/2014, 19:20
... uniformly L- Lipschitzian asymptotically pseudocontractive mapping in real Banach space,” Journal of Mathematical Analysis and Applications, vol 321, no 2, pp 722–728, 2006 [5] Y J Cho, J I Kang, and ... Chidume’s open questions and approximate solutions of multivalued strongly accretive mapping equations in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 216, no 1, pp 94–111, ... construction of fixed points of asymptotically nonexpansive mappings,” Journal of Mathematical Analysis and Applications, vol 158, no 2, pp 407–413, 1991 [3] S.-S Chang, “Some results for asymptotically...
- 8
- 236
- 0
Báo cáo lâm nghiệp: "Evapotranspiration of a declining Quercus robur (L.) stand from 1999 to 2001. I. Trees and forest floor daily transpiration" ppsx
Ngày tải lên :
08/08/2014, 00:22
... beginning of leaf fall, daily transpiration raised up to 1.8 mm d–1 Forest floor LAI (Fig 8) reached maximal values almost identical to oak LAI 508 C Vincke et al Figure Oak daily transpiration (T, ... values of 2–3 mm d–1 in oak [6, 10] In this case, these low values could be attributable to the low LAI or eventually local dryness Oak LAI is effectively lower than LAI of healthy trees of same ... the control one) The importance of LAI as a limiting factor of stand transpiration has been demonstrated [19] For each year and each plot, T/LAI was calculated for oaks and was always < 0.3 Except...
- 10
- 365
- 0
Báo cáo lâm nghiệp: "Evapotranspiration of a declining Quercus robur (L.) stand from 1999 to 2001. II. Daily actual evapotranspiration and soil water reserve" potx
Ngày tải lên :
08/08/2014, 00:22
... to leaf area development For periods of leaf area expansion and leaf fall, daily transpiration was calculated with an equation based on daily PET and on a relative LAI (LAIi/LAImax), with i standing ... maple, given in Mathieu [24] Table I summarises each plot’s basal area, LAI and SA for the years and for each type of species Total LAI was estimated from litter Evapotranspiration in a declining ... 16–17% in a 35 years old sessile oak stand with LAI of 3.3 The intra- and inter-annual variations, not always well correlated with LAI, probably result from (i) the type of rain and (ii) climatic...
- 9
- 319
- 0