reasoning with a hybrid of a visual display and mental imagery
Báo cáo hóa học: " Expression of the RNA-binding protein RBM3 is associated with a favourable prognosis and cisplatin sensitivity in epithelial ovarian cancer" ppt
... particularly in the treatment of testicular and ovarian cancer [2] Standard treatment for advanced EOC involves surgical debulking followed by adjuvant chemotherapy with a combination of a platinum ... covalent bonds with purine DNA bases which causes cross-linking of DNA and results in activation of several signal transduction pathways involved in DNA-damage repair, cell cycle arrest and apoptosis ... assisted with data collection and helped to draft the manuscript JB assisted with collection of clinical data MU assisted with data collection and participated in its design FP assisted with data collection...
- 12
- 531
- 0
Báo cáo toán học: "A Hybrid of Darboux’s Method and Singularity Analysis in Combinatorial Asymptotics" potx
... terms are available, given the nonconstructive character of classical Tauberian theory We state: Proposition The probability that a random permutation of size n has a square-root admits a full asymptotic ... Singularity analysis, Hadamard products, and tree recurrences, Journal of Computational and Applied Mathematics 174 (2005), 271–313 [11] Philippe Flajolet, Singularity analysis and asymptotics of ... Theoretical Computer Science 215 (1999), no 1-2, 371–381 [12] Philippe Flajolet, Xavier Gourdon, and Daniel Panario, Random polynomials and polynomial factorization, Automata, Languages, and Programming...
- 35
- 321
- 0
Báo cáo lâm nghiệp:" Comparison of soil water-contents as measured with a neutron probe and time domain reflectometry in a " ppsx
... porosity at each point (cm3 cm–3), and a is the anisotropy coefficient of the medium Based on experimental data, Jacobsen et al [10] have shown that a varies between 0.4 and 0.8, and Zakri et al [35] ... TDR, also obtained a higher bias with higher q values Finally, Salas Comparison between neutron probe and TDR Table III Summary of the ANOVA results (two-way ANOVA with paired-values): (a) Probe ... During March and April 1997 it was not possible to take Comparison between neutron probe and TDR 187 Table I Characteristics of the forest plot at Navasfrías (province of Salamanca, Western Spain)...
- 9
- 353
- 0
báo cáo khoa học: "Immediate breast reconstruction with a saline implant and AlloDerm, following removal of a Phyllodes tumor" pdf
... nipple-sparing mastectomy The superior or inferior periareolar with lateral extension, transareolar with perinipple and lateral-medial extension, transareolar and transnipple incision with medial and ... periphery of the flap and areola [19,20] The transareolar with perinipple and lateral-medial extension also provides good exposure and reduces the risk of ischemia to the lower portion of the areola ... disease of the epithelial and stroma tissue in the breast It is classified as benign, borderline, and malignant Malignant tumors have high stroma cellularity and tend to be permeative whereas...
- 5
- 453
- 0
Báo cáo y học: " Simultaneous monteggia type I fracture equivalent with ipsilateral fracture of the distal radius and ulna in a child: a case report" docx
... Monteggia injury with ipsilateral distal radius and ulna fractures [2]; olecranon fracture and distal radial epiphysis [3]; type II Monteggia fracture with fracture separation of the distal radial ... the radial head; the second most common is fracture of the proximal third of the ulna, lateral angulation of the fracture and lateral dislocation of the radial head; proximal ulna fracture with ... post-dislocation of the radial head; fracture of the proximal radius and ulna with dislocation of the radial head Three Monteggia equivalent fractures have been described: isolated radial head dislocation;...
- 4
- 338
- 0
Báo cáo y học: "Characteristics and outcomes of trauma patients with ICU lengths of stay 30 days and greater: a seven-year retrospective study" pdf
... GCS on admission were similar Univariate analysis showed that besides age and female gender, death was significantly associated with pre-existing cardiac, renal and neurological conditions, and ... have specifically addressed prolonged ICU stays in trauma patients Trottier and colleagues [3] analyzed 339 trauma and burn patients with ICU LOS of more than 28 days and found similar survival ... likely withdrawal of dialysis, pharmacological support, and mechanical ventilation [10] That patients aged 65 years and older accounted for almost 40% of the ILOS>30 group was reflective of our admission...
- 9
- 258
- 0
DEVELOPMENT OF a BLUEPRINT FOR COMPUTER BASED TRAINING (CBT) IN THE USE OF ELECTRONIC CHART DISPLAY AND INFORMATION SYSTEMS (ECDIS)
... ensure appropriate selection EXPLAIN ALL SAFETY-RELEVANT AS WELL AS OTHER MAJOR CHARACTERISTICS OF ECDIS DATA SUCH AS DATA CONTENTS, HANDLE ECDIS DATA ON BOARD AND ASSESS ALL ERRORS, INACCURACIES AND ... data”, presentation-independence of data, ENC and SENC 3.2 DATA STRUCTURE AND DATABASE: Explain - the data structure and databases of ECDIS, including objects and their attributes (object catalogue) ... of and ability to use navigational charts and publications, …” Criteria for evaluating competency are stated as “The charts selected are the largest scale suitable for the area of navigation and...
- 62
- 405
- 1
báo cáo hóa học: "Personal customizing exercise with a wearable measurement and control unit" potx
... The wearable unit was able to store small amounts of temporal data, and the completed data was processed in an external computer and then uploaded to the database via the Internet Additionally, ... biosignals Users wearing this unit can take advantage of various exercise programs using a variety of exercise machines A prototype of the wearable unit measured heart rate and EMG signals and wirelessly ... and continuous workload adjustment, based on the analysis of various biosignals, such as the heart rate (HR) and electromyogram (EMG) signals [1] Wearable units must offer these measurement and...
- 10
- 581
- 0
Báo cáo hóa học: " Research Article A New Hilbert-Type Linear Operator with a Composite Kernel and Its Applications" pot
... 2 Journal of Inequalities and Applications where the constant factors π and π are the best possible also Expression 1.2 is called a more accurate form of 1.1 Some more accurate inequalities ... inequality,” International Mathematical Forum, vol 2, no 37–40, pp 1831–1837, 2007 W Zhong, A Hilbert-type linear operator with the norm and its applications,” Journal of Inequalities and Applications, ... UK, 1934 B C Yang, “On a more accurate Hardy-Hilbert-type inequality and its applications,” Acta Mathematica Sinica, vol 49, no 2, pp 363–368, 2006 Chinese B Yang, “On a more accurate Hilbert’s...
- 18
- 340
- 0
báo cáo khoa học: "Imperforate anus with a rectovestibular fistula and pseudotail: a case report" pps
... representing an association of birth defects including vertebral anomalies, anal atresia, cardiovascular anomalies, tracheoesophageal fistula, esophageal atresia, renal or radial anomalies, and limb ... Figure Magnetic resonance imaging of pseudotail and sacrum This T2 fat-saturated coronal image demonstrates absence of a presacral mass, relatively normal appearance of the sacrum, and dilated rectum ... our hospital on her first day of life for evaluation and management of imperforate anus and a perineal mass The 20-year-old mother had standard prenatal care and an uncomplicated pregnancy She...
- 5
- 343
- 0
Cosmological model with a local void and observational constraints
... such as galaxy clusters, filaments, and voids gradually appear The over-density region has stronger gravitational attraction and, accordingly, it causes a larger deceleration of the expansion rate ... ν are of the range (0,1, 2,3) The expansion scalar θ is a measure of the fractional rate of change of A (see Chapter of [57]), and it follows that θ= ( ) A ∂ A ∂d a = = A ∂λ d a ∂λ A ∂λ (2.4) ... Tomita’s earlier analyses [35] and examine the variation of the confidence contours as the model parameters vary from their standard values We vary the parameters as follows: Hubble parameters ratio...
- 68
- 100
- 0
Báo cáo y học: "Grb2-associated binder 1 polymorphism was associated with the risk of Helicobactor pylori infection and gastric atrophy"
... GGT TTA AAC TTT ATT CTG ACT GTT CCC, R1: 5’ ACA CAA TTT AGT AAT AGC CAA AGT CAA C, F2: 5’ GTT GTT GTG AAG TAG AAA CTG ATT TCT AA, and R2: 5’ CTG GGG AGT GGG CCA Genomic DNA was applied in a volume ... gastric atrophy (GA) of Gab1 and the combinations of PTPN11 and Gab1 genotypes among seropositive healthy controls Genotype Gab1 G/G G /A A /A G /A+ A /A Total PTPN11b Gab1 G /A+ A /A G/G G /A+ A /A G /A+ A /A ... polymorphism was not associated with gastric cancer When we made a comparison between cases and controls with seropositive atrophy, the ORs of G /A and A/ A for gastric cancer were also each insignificant...
- 6
- 541
- 0
Báo cáo y học: "Duration of red blood cell storage is associated with increased incidence of deep vein thrombosis and in hospital mortality in patients with traumatic injuries" potx
... comparison of non-parametric continuous data The Fisher Exact or Chi Squared test was used for comparison of categorical data as appropriate Variables with a P value of less than 0.1 on univariate ... manuscript preparation CEW contributed to study design, data analysis and manuscript preparation JBH contributed to study design, data analysis and manuscript preparation All authors read and approved ... the time of death Organ failure at time of death was defined as follows: cardiac failure as requiring vasoactive agents, pulmonary failure as requiring mechanical ventilation with radiographic evidence...
- 11
- 523
- 0
The Handbook of Chicana/o Psychology and Mental Health pdf
... Behaviors of Chicana/o and Latina/o Adolescents: An Analysis of Prevalence, Risk, and Protective Factors Manuel Barrera, Jr., Nancy A Gonzales, Vera Lopez, and A Cristina Fernandez 83 Folk Healing ... problems Mental Health and Acculturation of Latina/o Hispanics There are increasing amounts of data pertaining to the effects of acculturation on Latina/o mental health In fact, this area of research ... concept of the duality of origin and life emerged from the cultures of Indian nations of Central and South America and the Caribbean Polar opposites—male and female, religion and war, poetry and math—were...
- 539
- 523
- 1
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... quality of individual articles has shown a sample size of 50 patients in the smallest group as acceptable.46 Randomization Sixty patients were randomly assigned into each group from a total of ... al Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Australian population with chronic low back pain Ann Rheum Dis 1995; 54: 100-6 Manchikanti L, Singh V, Pampati...
- 12
- 669
- 0
A kinetic study of resorcinol-enhanced hydroxyl radical generation during ozonation with a power law type equation
... Hakoda M., Shimbara S., Nagaoka H., Chung Y and Hamada A (1994) Active oxygen species generated during chlorination and ozonation Water Sci Technol., 30, 91-99 Utsumi H., Han S.K and Ichikawa ... Science Foundation REFERENCES Andreozzi R., Caprio V., Insola A and Marotta R (1999) Advanced oxidation processes (AOP) for water purification and recovery Catal Today, 52, 51-59 Bader H and Hoigne ... radical generation 1.5-fold that of phenol itself Power law type rate equations are usually adopted to correlate the experimental data in laboratory-scale and pilot-plant scale reactors, and even...
- 7
- 569
- 0
A Brief Tour of the X Display Environment
... on a laptop and the X application (i.e., client) that you want to run is located on a remote system You can arrange to have the application output display on the laptop The following paragraphs ... DISPLAY= ron.mydomain.com:0 Any X applications started after the DISPLAY variable is set will use that value and the application window will show up on that X server Of course, I could set my display variable to ... end of the tunnel is on Machine A, which is where the application is actually displayed The authority and display are now set on Machine C You should be able to run an X application on Machine...
- 10
- 403
- 0
A three phase voltage type PWM rectifier with the function of an active power filter
... term of the n -th harmonic component of i,, Though the AC components are also contained in the output signal of the integrator, they can be made small by the integral action of the integrator and ... sinusoidal waveform in compliance with the sinusoidal reference signal and , that the current i has a nearly rectangular waveform due to the existence of a smoothing reactor Fig3(b) shows the waveform ... on another occasion (c) Waveforms of vw, isu and Vd Fig.4 Experimental waveforms after harmonic compensation 100.00 before compensation - REFERENCES 10.00 I 0 Sugita T, NezuK, Sat0 Y and KataokaT...
- 6
- 479
- 1
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... carcinoma cells Oncogene 20, 2499–2513 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated and supports ... conclude that it interacts with the activated forms of STAT3 and STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic activities, and they regulate each others activity ... RHN(CH2)6CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2)3 NHR (hpST3dODN), which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH2)3NHR...
- 11
- 558
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25