Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing ` ´ Ali Tadlaoui Hbibi1,2, Christelle Laguillier1,2, Ines Souissi1,2, Denis Lesage1,2, Stephanie Le Coquil1,2, An Cao3, Valeri Metelev4, Fanny Baran-Marszak1,2,5 and Remi Fagard1,2,6 ´ ´ Institut National de la Sante et de la Recherche Medicale, U978, Bobigny, France ´ Universite Paris 13, UFR SMBH Bobigny, France Centre National de la Recherche Scientifique, UMR 7033, Bobigny, France Department of Chemistry, Moscow State University, Russia ˆ ´ AP-HP, hopital Avicenne, service d’hematologie, Bobigny, France ˆ AP-HP, hopital Avicenne, service de biochimie, Bobigny, France Keywords cell death; hairpin decoy oligonucleotide; interferon-c; STAT1; STAT3 Correspondence ˆ R Fagard, service de biochimie, hopital Avicenne 125 rue de Stalingrad, 93009 Bobigny Cedex, France Fax: +33 014 895 5627 Tel: +33 014 895 5928 E-mail: remi.fagard@avc.aphp.fr (Received 17 November 2008, revised 25 January 2009, accepted 19 February 2009) doi:10.1111/j.1742-4658.2009.06975.x The signal transducers and activators of transcription (STATs) convey signals from the membrane to the nucleus in response to cytokines or growth factors STAT3 is activated in response to cytokines involved mostly in cell proliferation; STAT1 is activated by cytokines, including interferon-c, involved in defence against pathogens and the inhibition of cell proliferation STAT3, which is frequently activated in tumour cells, is a valuable target with respect to achieving inhibition of tumour cell proliferation Indeed, its inhibition results in cell death We previously observed that inhibition of the transcription factor nuclear factor-jB, a key regulator of cell proliferation, with decoy oligodeoxynucleotides results in cell death We used a similar approach for STAT3 A hairpin STAT3 oligodeoxynucleotide was added to a colon carcinoma cell line in which it induced cell death as efficiently as the STAT3 inhibitor stattic The hairpin STAT3 oligodeoxynucleotide co-localized with STAT3 within the cytoplasm, prevented STAT3 localization to the nucleus, blocked a cyclin D1 reporter promoter and associated with STAT3 in pull-down assays However, the same cells were efficiently killed by interferon-c This effect was counteracted by the STAT3 oligodeoxynucleotide, which was found to efficiently inhibit STAT1 Thus, although it can inhibit STAT3, the hairpin STAT3 oligodeoxynucleotide appears also to inhibit STAT1-mediated interferon-c cell killing, highlighting the need to optimize STAT3-targeting oligodeoxynucleotides Signal transducer and activators of transcription (STATs) are a family of transcription factors that are activated in response to cytokines regulating cell proliferation, differentiation, inflammation, the immune response, apoptosis and fetal development [1] Sche- matically, the inactive STATs are cytoplasmic; once activated, they dimerize and enter the nucleus where they induce the expression of target genes [2] Several studies have demonstrated that STAT3 is a key regulator of cell proliferation It was shown to be a Abbreviations FITC, fluorescein isothiocyanate; GAS, c-activated sequence; IFN, interferon; IL, interleukin; IRF, interferon regulatory factor; NF, nuclear factor; ODN, oligodeoxynucleotide; PARP, poly(ADP-ribose) polymerase; STAT, signal transducer and activator of transcription; TEAPC-chol, 3b-[N-(N ¢,N ¢,N ¢-triethylaminopropane)-carbamoyl] cholesterol iodide FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS 2505 STAT3 hairpin decoy oligonucleotide cell killing A Tadlaoui Hbibi et al major effector of epidermal growth factor receptor signalling [3–5] and of cytokines such as interleukin (IL)-6 [6] It is also involved in transformation and tumour progression [7] and its activation, as detected in breast, head and neck, lung and colon cancers [8], is considered to be a marker of poor prognosis The role played by STAT3 in malignant cell growth is mediated in part by the up-regulation of the expression of genes involved in cell survival and proliferation, including those for Bcl-xl, Bcl-2, c-Myc, cyclin D1, survivin, Mcl-1, vascular endothelial growth factor, IL-10 and transforming growth factor b [9–13] The constitutive activation of STAT3 observed in many tumours and tumour cell lines suggests that it may be a good target for the induction of cell death Several therapeutic approaches have been developed to inhibit STAT3, including inhibition of its expression [14,15], inhibition of its dimerization [16,17] and inhibition of its binding to the DNA promoter sequence using decoy oligodeoxynucleotides (ODN) [18,19] ODNs comprise a valuable approach for inhibiting transcription factors because they have the potential to inhibit transcriptional function without affecting other nontranscriptional functions They have been successfully used in the treatment of some diseases, including rheumatoid arthritis [20] or atopic dermatitis [21] In cancer cell lines, the STAT3 ODNs were shown to inhibit cell proliferation [18,22] How the STAT3 decoy ODNs interact with STAT3 within cells, including how they affect its function, has not been thoroughly investigated One potential difficulty regarding specific targeting of STAT3 is that it shares 72% sequence homology with STAT1 STAT3 and STAT1 are generally recognized to be antagonistic, with STAT3 functioning as a proliferation activator and STAT1 as an inhibitor [23–25], this antagonism is further illustrated by the fact that cytokines, such as IL-6, which favour cell proliferation, activate principally STAT3, whereas cytokines, such as interferon (IFN)-a ⁄ b or IFN-c, which favour cell death, activate principally STAT1 However, despite their different functions in cells, STAT3 and STAT1 recognize very similar sequences on the gene promoters and share common targets; they can also form heterodimers, whose function has not been clearly elucidated In the present study, we focussed on the colorectal carcinoma cell line SW480, in which STAT3 is constitutively activated [26] and found that SW480 cells were efficiently killed by the hpST3dODN SW480 cells were also efficiently killed by IFN-c treatment, and this action was counteracted by hpST3dODN, which reduced transcriptional activity and nuclear localization of STAT1 after IFN-c treatment Thus, although IFN-c treatment did not impair hpST3dODN-induced 2506 cell killing, IFN-c-induced cell killing was impaired by hpST3dODN, most likely as a result of its interaction with activated STAT1 Results The hairpin STAT3 decoy ODN induces cell death of the colon carcinoma SW480 cells To examine the transfection efficiency of hpST3dODN into cells, we applied different concentrations of the fluorescein isothiocyanate (FITC)-labelled hpST3d ODN combined with cationic lipid and analysed the intensity of FITC fluorescence by flow cytometry Transfection efficiency increased with increasing ODN amounts (0.5, and lgỈmL)1) but not linearly, suggesting the possibility of a saturable mechanism of entry (Fig 1A); identical results were obtained with a control ODN (not shown) Examination of the cells by light microscopy showed that untreated cells, cells treated with empty liposomes and cells treated with control ODN were identical and had a normal appearance, whereas cells treated with hpST3dODN became rounded and were detached from the culture dish (not shown) To further analyse cell death induced by hpST3dODN, different concentrations of ODN were added to cells (0.5, and lg) or, alternatively, a control ODN was used (1 and lg) After 48 h of culture, cell death was determined by measuring trypan blue uptake; the number of dead cells increased with hpST3dODN concentration (0.5, and lg), whereas control ODN (1 and lg) or the liposomes alone had little effect (Fig 1C) Kinetic analysis showed that cell death was undetectable after 12 h, and became detectable after 16, 24 and 48 h (Fig 1B); after 72 h, the amount of dead cells and debris made it difficult to count dead cells Analysis by flow cytometry clearly showed the cells that had incorporated hpST3dODN (FITC positive) were those that were dying (PI positive) (Fig 1D) hpST3dODN was also applied to the 2C4 fibroblastic cell line in which STAT3 is not constitutively activated There was no effect on cell viability, despite the fact that hpST3dODN could efficiently enter the cells (not shown) However, curcumin, a nonspecific inhibitor [27,28], could kill the cells (Fig 1E) as efficiently as SW480 cells (not shown) To further explore the sensitivity of SW480 cells to STAT3 inhibition, the inhibitor stattic, which is considered to be specific to STAT3 [29], was used and trypan bluepositive cells counted Increased cell death was observed (Fig 1F), thus strengthening the notion that specific inhibition of STAT3 is sufficient to induce the death of these cells Interestingly, in stattic-treated 2C4 FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS STAT3 hairpin decoy oligonucleotide cell killing D FITC lab intensity A 100 80 60 40 20 0.5 PI/FITC-pos cells (%) A Tadlaoui Hbibi et al 25 20 15 10 n e ODN (µg) ODN (µg) Cont (µg) Dead cells (%) E Dead cells (%) B 30 20 10 Time (h) 16 24 48 16 24 48 n 16 24 48 ODN (2 µg) 30 2C4 15 10 E Lip ODN cont Curc Contr F Dead cells (%) C Dead c cells (%) 0.5 30 15 10 n e 0.5 ODN (µg) 80 60 40 20 10 Cont (µg) 10 15 30 40 Stattic (µM) Fig Cell death induced by treatment of the SW480 colon carcinoma cell line with the STAT3 decoy ODN (A) Efficient incorporation of FITC-STAT3 decoy ODN into SW480 cells using decoy ⁄ lipid complexes After h of incubation, cells were placed in fresh culture medium containing 10% serum for 24 h Fluorescence intensity was measured by flow cytometry after treatment with lipids combined with increasing concentrations of FITC-labelled hpST3dODN in the range 0.5–2 lg (B) SW480 cells were treated with empty lipids (n), hairpin decoy ODN (2 lg) or control ODN (con) and the dead cells were counted after 16, 24 and 48 h of culture using trypan blue staining (C) Cells were treated with 0.5, and lg of hpST3dODN and and lg of control ODN for h or with lipids only; after 48 h of culture, they were stained with trypan blue and counted (n, untreated cells; e, empty liposomes) (D) Cells were treated as described in (C) and then analysed by flow cytometry for propidium iodide (PI) and FITC uptake, the results shown are for the cells that are positive for both PI and FITC uptake (E) Cells of the fibroblastic line 2C4 were treated with empty lipids (E lip), hairpin decoy ODN, control ODN (con) and curcumin (40 lM) (curc) and the dead cells were counted after 48 h of culture using trypan blue staining (F) Cells were treated with concentrations of Stattic in the range 0–30 lM, stained with trypan blue and dead cells were counted To facilitate the comparison of different experiments, the results are expressed as a percentage cells (in which STAT3 is not activated), there were 5% dead cells with 10 lm stattic, (28% in SW480), 10% with 15 lm (35% in SW480), 25% with 30 lm (45% in SW480) and 35% with 40 lm (60% in SW480) The hairpin STAT3 decoy ODN inhibits the transcriptional activity of STAT3 and colocalizes with STAT3 to the cytoplasm of SW480 cells The transcriptional activity of STAT3 after treatment of the cells with hpST3dODN was analysed in SW480 cells transfected with a cyclin D1-promoter luciferase reporter The luminescence of cell extracts, measured 24 h after transfection, was found to decrease by 86%, whereas control ODN had no measurable effect (Fig 2A) To assess the specificity of the effect of ODN, we verified that the hST3dODN did not inhibit the nuclear factor (NF)-jB-luciferase reporter in these cells and that the NF-jB inhibitory ODN [30] did not inhibit the cyclin D1-luciferase reporter (not shown) To determine whether the subcellular localization of STAT3 had been modified by ODN, fluorescence microscopy was employed In untreated SW480 cells, phospho-STAT3 was detectable in the cytoplasm and nucleus (Fig 2B) In FITC-labelled hpST3dODNtransfected cells, phospho-STAT3 was detected in the cytoplasm, but not in the nucleus, and ODN was detected only in the cytoplasm (Fig 2C), suggesting that hpST3dODN somehow prevented the nuclear localization of phospho-STAT3 Indeed, in cells that FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS 2507 B C Cont ODN A Tadlaoui Hbibi et al 800 600 400 200 No add STAT3 STAT3 STAT3 ODN DAPI Merge DAPI Merge DAPI Merge were either not treated (Fig 2B) or treated with control ODN (Fig 2D), phospho-STAT3 was found within the nucleus The hairpin STAT3 decoy ODN also disrupts IFN-c-induced STAT1 signalling Because STAT3 and STAT1 share a high degree of homology and bind to similar promoter sequences, they are likely to interact with the same ODN Although hpST3dODN induced the death of SW480 cells, and blocked the transcriptional activity of STAT3, it was important to verify whether, within cells, this ODN was STAT3-specific or could also interact with STAT1 and disrupt its signalling In colorectal carcinoma cells, treatment with IFN-c sensitizes cells to cytotoxic compounds, and can also induce cell death on its own [11,25,31,32] Experiments were performed to determine whether this was also observed in SW480 cells IFN-c, at 200 ngỈmL)1 for 48 h, efficiently killed the cells; however, lower concentrations (10 ngỈmL)1) and shorter exposures (4 h) had no effect on cell death (Fig 3A) In addition, treatment of the cells with 100–200 ngỈmL)1 IFN-c for 24–48 h induced poly(ADP-ribose) polymer- 2508 Fig Transcriptional activity and subcellular localization of STAT3 are altered in STAT3 decoy ODN-treated SW480 cells (A) Inhibition of the transcriptional activity of STAT3 by hpST3dODN SW480 cells were cotransfected with a cyclin D1-luc plasmid, treated with either hpST3dODN or a control ODN and the luciferase activity measured after 24 h of incubation The relative STAT3 transcriptional activity in transfected cells is shown Each transfection experiment was performed in triplicate Subcellular location of phospho-STAT3 analysed by fluorescence microscopy: (B) in nontreated cells, phophoSTAT3 was cytoplasmic and nuclear; (C) in hpST3dODN-treated cells, STAT3 was almost exclusively cytoplasmic and not detected in the nuclei (arrow); the FITClabelled hpST3dODN was also cytoplasmic; (D) in control ODN-treated cells, phosphoSTAT3 was mostly nuclear, as in control cells; the ODN was mostly cytoplasmic (scale bar = 10 lm) Cont ODN A 70 Dead cells (%) A Cyclin D1-Luciferase activity (Rlu per µg prot) STAT3 hairpin decoy oligonucleotide cell killing 60 50 40 30 20 10 IFN-γ (ng·mL–1) 10 100 200 cPARP actin 24 h cPARP actin B 48 h IFN-γ (ng·mL–1) 20 100 200 Fig Treatment with IFN-c induces cell death of SW480 cells (A) SW480 cells were incubated in the absence of IFN-c or with 10, 100 and 200 ngỈmL)1 for 4, 24 and 48 h of incubation and cell death was measured by trypan blue exclusion Each experiment was performed in triplicate The results are expressed as a percentage of dead cells (B) Cleavage of PARP, induced by 24 or 48 h of treatment with IFN-c at 5, 20, 100 and 200 ngỈmL)1 was analysed by western blotting using anti-cleavedPARP serum FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS STAT3 hairpin decoy oligonucleotide cell killing A 2500 2000 1500 1000 500 B D ODN hpST3dODN binds both STAT3 and STAT1 The results obtained indicate that hpST3dODN is acting on both STAT3 and STAT1 and that it has the potential to interfere with the biological activity ODN Contr IFN-γ IFN STAT1 A DAPI Merge STAT1 Contr-ODN ase (PARP) cleavage (Fig 3B) The transcriptional activity of STAT1, as measured with an interferon regulatory factor (IRF) 1-promoter luciferase reporter after treatment of IFN-c-treated cells with hpST3dODN (1 lgỈmL)1), was considerably reduced compared to the effect of control ODN (Fig 4A) The subcellular localization of STAT1 was also modified by treatment with hpST3dODN In IFN-c-treated cells, STAT1 was detected in the nucleus (Fig 4B); in cells treated with hpST3dODN, STAT1 remained in the cytoplasm and was found to colocalize with ODN (Fig 4C); and, in cells treated with control ODN, the nuclear translocation of STAT1 occurred normally (Fig 4D) These observations suggest that hpST3dODN could interfere with STAT1, a key signalling factor for IFN-c Accordingly, cell death was analysed in SW480 cells after treatment with IFN-c and the addition of hpST3dODN In cells that were treated with IFN-c, the addition of hpST3dODN reduced cell death by more than 50% (Fig 5A); interestingly, such a reduction of IFN-cinduced cell death was not observed when treating cells with stattic, a compound that binds the SH2 domain of STAT3 with high affinity (Fig 5B) No add Dead cells (%) C IRF1 DAPI Merge 40 20 10 + IFN-γ (ng·mL–1) ODN 0 + Control B 70 60 50 40 30 20 10 Stattic (µM) 0 + + 0 100 200 100 200 100 200 0 0 + + Dead cells (%) Fig Transcriptional activity and subcellular localization of STAT1 are altered in STAT3 decoy ODN-treated SW480 cells (A) SW480 cells were transfected with an IRF-1-luc plasmid, treated with IFN-c at 20 ngỈmL)1, and either not treated (no add.), treated with hpST3dODN (ODN) or treated with control ODN (contr.); after 24 h of incubation, luciferase activity was measured Each transfection experiment was performed in triplicate Subcellular location of STAT1 determined by fluorescence microscopy: (B) cytoplasmic location of STAT1 in untreated cells and nuclear location in IFN-c treated cells (20 ngỈmL)1); (C) cytoplasmic location of phospho-STAT1 (red) in hpST3dODN-treated (1 lg) SW480 cells that had been treated with IFN-c (20 ngỈmL)1); the decoy ODN (green) was also cytoplasmic; (D) nuclear location of STAT1 (red) in cells treated with control ODN (green) (scale bar = 10 lm) Luciferase activity (Rlu per µg prot) A Tadlaoui Hbibi et al IFN-γ (ng·mL–1) 0 15 15 15 100 200 100 200 Fig Inhibition of IFN-c-induced cell death by the STAT3 decoy ODN in SW480 cells (A) Cells were either treated with lg of hpST3dODN or control ODN for h, with IFN-c alone or with ODN and IFN-c; after 48 h of culture, they were stained with trypan blue and counted (B) Cells were either not treated, or treated with stattic alone, IFN-c alone or both combined together After 48 h of incubation, dead cells were counted using trypan blue exclusion of IFN-c In the SW480 cell line, IFN-c treatment resulted in the inhibition of the STAT3-dependent cyclin D1 promoter, and activation of the STAT1- FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS 2509 STAT3 hairpin decoy oligonucleotide cell killing Cyclin D1 A A Tadlaoui Hbibi et al interaction of both STAT1 and STAT3 with hpST3dODN, pull-down experiments were performed using a biotinylated version of this ODN This was followed by gel separation and western blotting with anti-phospho-STAT1 or anti-phospho-STAT3 The results obtained show that, in SW480 cells that have not been stimulated, there is a basal level of binding of phospho-STAT3 to hpST3dODN This binding is increased in cells treated with IL-6 and, to a lesser extent, in cells treated with IFN-c (Fig 6C, lanes and 2) On the other hand, binding of phospho-STAT1 is detected only in cells that have been treated with IFN-c (Fig 6C, lane 3) IRF1 200 2000 100 1000 0 IFN-γ (100 ng·mL–1) + IFN-γ (100 ng·mL–1) + Western blotting B IFN-γ (ng·mL–1) 20 100 200 P-STAT1 STAT1 P-STAT3 STAT3 Discussion – – Pull-down – + + – – + C IFN-γ IL6 + – P-STAT1 P-STAT3 Fig Binding of the STAT3 decoy ODN to STAT3 and STAT1 (A) SW480 cells were transfected with a cyclin D1-luc plasmid (left panel) or an IRF1-luc plasmid (right panel) and either treated or not with IFN-c at 100 ngỈmL)1 After 24 h of incubation, luciferase activity was measured Relative STAT1 and STAT3 transcriptional activities in transfected cells are shown (B) Phosphorylation levels of STAT3 and STAT1 in SW480 cells after treatment with different concentrations of IFN-c analysed by western blotting using antiP-STAT1 and anti-P-STAT3 sera (C) Interaction of the STAT3 decoy ODN with STAT3 and STAT1 as determined by pull-down assays Cells were treated with biotinylated hpST3dODN (1 lg) (lanes 1, and 3) or control biotinylated ODN (lanes and 5) for 16 h and lysed; the complexes were bound to streptavidine and separated on gels Cells were either not treated (lane 1), treated with IL-6 (30 ngỈmL)1, lanes and 4) or treated with IFN-c (100 ngỈmL)1, lanes and 5) Western blotting was performed using antiphospho-STAT3 and anti-phospho-STAT1 sera Identical amounts of cellular extracts were used, as determined by the Bradford method The experiment was repeated several times, with identical results being obtained dependent IRF1 promoter (Fig 6A) To determine whether this correlated with phosphorylation levels, the phosphorylation of STAT1 on tyrosine 701, and of STAT3 on tyrosine 705, was examined in IFN-c-treated SW480 cells STAT1 phosphorylation increased dramatically, even at the lowest concentration used, whereas STAT3 phosphorylation never increased by more than twofold (Fig 6B) In the absence of IFN-c treatment, there was a low but clearly detectable phosphorylation of STAT3 Finally, to analyse the 2510 In the present study, we observed that a hairpin decoy ODN targeting STAT3 (hpST3dODN) induces cell death of the carcinoma cell line SW480, apparently by trapping STAT3 within the cytoplasm The hairpin decoy, but not control ODN, inhibited cell proliferation, eliminating any possible effects as a result of the introduction of DNA within cells, and indicating that, in itself, the interaction of ODN with STAT3 induced these effects (i.e inhibition of the cyclin-D1-dependent promoter, colocalization with STAT3 and STAT3 binding in pull-down assays) Our data indicate a correlation between inhibition of STAT3 by hpST3dODN and induction of cell death In addition, they confirm previous observations made in head and neck nonsquamous carcinoma cell lines, with a nonhairpin ODN containing the c-activated sequence (GAS) sequence [18] Taken together with our observation that ODN does not kill the fibrosarcoma cell line 2C4, in which STAT3 is not activated, these results suggest that the effect of ODN may be restricted to cells in which STAT3 is activated These results are also in agreement with a previous study showing that inhibition of the constitutively activated Janus kinase ⁄ STAT3 pathway with AG490 resulted in the diminished viability of SW480 cells [26] The mechanism by which hpST3dODN inhibits STAT3 is not clearly understood Our immunofluorescence microscopy data suggest that activated STAT3 may be trapped by ODN within the cytoplasm This view is supported by our pull-down assays, which indicate a direct interaction of hpST3dODN with activated STAT3 Cytoplasmic trapping of a transcription factor was previously observed in the laboratory with a NF-jB decoy ODN [30], indicating that the mechanism involved is probably not specific to one transcription factor Nevertheless, the mechanism by which binding of a hairpin to STAT3 prevents nuclear entry FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS A Tadlaoui Hbibi et al is not understood Because nuclear transport is a highly regulated process, one possibility is that binding to hpST3dODN modifies the conformation of key components of the STAT3 protein complex, thereby impairing normal interaction with the nuclear transport machinery Alternatively, the hairpin ODN itself might interact with components of the nuclear transport machinery through its hairpin structure Although the combination of induced cell death, inhibited transcription activity and nuclear entry strongly indicates that hpST3dODN functions by preventing nuclear entry, further studies are required, including cell fractionation assays, to directly demonstrate this proposal and to identify the cellular components involved Nevertheless, these results suggest that nuclear entry of a decoy ODN is not a prerequisite for the inhibition of transcription factors, as previously assumed [33] There is an intriguing similarity between STAT3 and STAT1 Both factors share activating stimuli and a high homology of sequence, and they have common gene targets and recognize very similar consensus sequences; yet, they have clearly distinct functions in cells STAT3 is mostly involved in cell survival and proliferation, and STAT1 is involved in anti-viral and immune defence and cell death, in response to interferons, including IFN-c [34] Inhibition of STAT1 using GAS-based decoy ODNs was previously found to efficiently inhibit inflammation-linked processes such as graft rejection [35,36], arthritis [37] and contact hypersensitivity [38] The decoy ODN used in these studies was considered STAT1-specific However, a recent study, using a GAS sequence-based nonhairpin decoy ODN [39] to inhibit STAT3 in head and neck squamous carcinoma cell lines, although demonstrating inhibition of IFN-c-activated STAT1, concluded that there was an absence of interference with STAT1mediated actions The present study of the colon carcinoma cell line SW480 demonstrates that IFN-ctreatment induces cell death, using conditions similar to previous studies [31,32,40] Treatments of at least days with IFN-c concentrations of at least 100 ngỈmL)1 are necessary; indeed, when using lower concentrations of IFN-c [39], we did not observe any cell killing If the decoy ODNs used not discriminate between STAT3 and STAT1, then a STAT3 decoy ODN may potentially inhibit the action of IFNc because STAT1 has long been recognized as a key component of this action [23] We therefore verified whether hpST3dODN inhibited STAT1, and whether this would result in an impaired action of IFN-c The results obtained demonstrate that, in the SW480 cell line, hpST3dODN inhibited STAT1: it inhibited its transcriptional activity on an IRF1 reporter and its STAT3 hairpin decoy oligonucleotide cell killing nuclear localization, which is associated with inhibited IFN-c-induced cell death Although these results could mean that STAT3 has no effect on IFN-c-induced cell death, they show that, in our cell system, the action of hpST3dODN must be interpreted with caution because it has the potential to inhibit IFN-c-induced cell death Alternatively, the STAT3-inhibitor stattic did not prevent cell death induced by IFN-c Because the hairpin decoy STAT3 ODN induces cell death of the nontreated SW480 cells in which there is a constitutive level of activated STAT3, which is necessary for the survival of these cells [30], and because it inhibits STAT1 in these cells when they are treated with IFN-c, we can tentatively conclude that it interacts with the activated forms of STAT3 and STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic activities, and they regulate each others activity Thus, the inhibition of both factors in vivo may have unpredictible results For example, in cardiac ischaemia, the action of STAT3 is protective and that of STAT1 increases cardiomyocyte apoptosis [41,42] Thus, the inhibition of STAT3 using decoy ODNs that are not strictly STAT3-specific may lead to unpredictable results (particularly in whole animals) by impairing the action of STAT1-dependent interferon The results obtained in the present study, including the ability of the hairpin decoy STAT3 ODN to inhibit both activated STAT3 and STAT1, also reveal that, in SW480 cells, survival may depend in part upon an equilibrium between the two STATs This equilibrium is in favour of activated STAT3 in our untreated colocarcinoma cells, and is tilted in favour of activated STAT1 in IFN-c-treated cells Such an equilibrium was observed in cells treated with the Janus kinasefamily inhibitor AG490, where only limited potentiation of the pro-apoptotic effect of doxorubicin was found, whereas inhibition of STAT3 with a dominant negative or a platinum derivative increased the pro-apoptotic effect of doxorubicin [43] Thus, the efficiency of blocking STAT3 may depend on the absence of the inhibition of STAT1 Indeed, cell death induced by ODN and by IFN-c may be the result of completely different mechanisms Furthermore, ODN might trap STAT1 ⁄ STAT3 heterodimers whose function remains to be elucidated One way to explore the complex interaction between STAT1 and STAT3 in SW480 cells is to suppress their expression Such an approach is indeed in progress in our laboratory: using shRNA transduction, we are presently examining whether STAT3 silencing causes proapoptotic effects and whether STAT1 silencing causes anti-apoptotic effects FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS 2511 STAT3 hairpin decoy oligonucleotide cell killing A Tadlaoui Hbibi et al The involvement of STAT1 may depend on the cell line used In some cell lines, ODN bound both STAT3 and STAT1 but did not inhibit STAT1 [32] However, the functions of STAT1 and STAT3 differ considerably and this must depend at some point on the specific recognition of a DNA-binding motif Specific inhibition of STAT3 by DNA-binding targeting may require an improved consensus sequence that would be recognized principally by STAT3 As noted above, an NF-jB decoy ODN induced cell death in the same cells [30], suggesting that the STAT3 and the NF-jB pathway are connected in these cells, as described in other systems in which cytokines, secreted as a result of NF-jB activation, activate STAT3 Unphosphorylated STAT3-dependent activation of NF-jB has also been reported [35], although our data indicate that the hairpin ODN blocks activated STAT3 and may not inhibit unphosphorylated STAT3 Preparation of liposomes Liposomes were formulated using a cationic lipid, 3b-[N(N¢,N¢,N¢-triethylaminopropane)-carbamoyl] cholesterol iodide (TEAPC-Chol) and neutral colipid dioleoyl phosphatidylethanolamine, as previously described [25] Briefly, TEAPC-Chol and dioleoyl phosphatidylethanolamine were mixed at a ratio of : (w ⁄ w) and dissolved in chloroform The solution was dried in vacuum Sterile water was then added and the mixture was sonicated to clarity for h in cycles of 15 Using light scattering, we found that the size distribution of the liposomes was unimodal The concentration of cationic lipid was monitored by UV spectroscopy at 226 nm and the value was used to calculate the charge ratio, assuming one positive charge for each cationic lipid molecule Transfection using liposomes Experimental procedures Cell culture SW480 (colon), 2C4 (fibrosarcoma) cell lines were grown in 10% FBS ⁄ DMEM (Gibco BRL, Life Technologies, CergyPontoise, France), 100 mL)1 penicillin, 10 lgỈmL)1 streptomycin (Gibco BRL), mm sodium pyruvate (Gibco BRL), MEM vitamins 100 · (Gibco BRL) and lgỈmL)1 plasmocin (Cayla InvivoGen, Toulouse, France) Curcumin was obtained from Acros Organics (Halluin, France) Synthesis of the hairpin STAT3 decoy ODN The oligodeoxynucleotides used comprised: RHN(CH2)6CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2)3 NHR (hpST3dODN), which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH2)3NHR (mutated hairpin control ODN) (Sigma-Proligo; Sigma-Aldrich Corp., St Louis, MO, USA), where R is either H, FITC or biotin To synthesize oligodeoxynucleotides with biotin, 7–10 nmol of the oligodeoxynucleotide bearing 3¢- and 5¢-aminoalkyl linkers were dissolved in 20 lL of 0.1 m NaHCO3 EZ-Link NHS-biotin (Pierce, Rockford, IL, USA) (10 lL of a 65 mm solution in dimethyl sulfoxide) was added, and the mixture was incubated at room temperature for 6–16 h in the dark Next, 25 lL of water were added, and the modified oligodeoxynucleotide was separated from the excess of hydrolyzed reagent by two consecutive separations on Micro Bio-Spin columns (Bio-Rad, Foster City, CA, USA) in accordance with the manufacturer’s instructions After the second spin, the biotinylated oligodeoxynucleotide was precipitated with 2512 ethanol-sodium acetate In control experiments, the previously described NF-jB decoy ODN [30] was used Cells were grown in four-well plates to a density of 0.5 · 106 cellsỈmL)1 When the cells reached 50–60% confluence, they were transfected with hpST3dODN or the hairpin control ODN (0.5, and lg corresponding to 100, 200 and 400 nm, respectively) in 150 lL of DMEM medium (without stromal vascular fraction cells) combined with the liposomes (0.5, or lg of cationic lipid), thus yielding liposome : ODN ratios of 0.5 : 0.5, : 2, : 0.5 and : (lg ⁄ lg) After h at 37 °C in a humidified 5% CO2 incubator, the cells were placed in fresh serumcontaining medium Expression was analysed after 48 h In control experiments, the liposomes were used alone at the same lipid concentrations Flow cytometry, cell viability The uptake of FITC-labelled hpST3dODN was measured by flow cytometry, gating on the FL1-positive signal on an EPICS XL Beckman-Coulter counter (Beckman Coulter, Villepinte, France) To measure the rate of cell death, cells were resuspended in annexin V-binding buffer, incubated with lL of propidium iodide (BD Pharmingen, Morangis, France) and analysed in a EPICS XL Beckman-Coulter counter Cell viability was assessed using the trypan blue exclusion method Luciferase activity To measure the transcriptional activity of STAT3 and STAT1, cells were transfected with either the cyclin D1 luciferase 1745 promoter [44] (a generous gift of R Pestell, Kimmel Cancer Center, Jefferson University in FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS A Tadlaoui Hbibi et al Philadelphia, PA, USA) or the IRF-1 luciferase promoter (a generous gift of P Kovarik, University of Vienna, Austria) Cells were then transfected with hpST3dODN or the hairpin control ODN (1 lg, corresponding to 200 nm) combined with liposomes After 24 h of incubation, cells were lyzed for 30 on ice with lysis buffer (10 mm Tris– HCl, pH 7.5, mm EDTA, 100 mm NaCl, 1% NP40 and mm dithiothreitol) In control experiments, the transcriptional activity of NF-jB was analysed using the NF-jB-luc 0.4K-luc plasmid (a generous gift of A Israel, Institut ă Pasteur, Paris, France) The lysates were centrifuged at 18 000 g for 10 at °C Supernatants were collected and assayed for luciferase activity using the Luciferase Assay kit (Promega, Madison, WI, USA) and a luminometer (Clarity, Fisher Bioblock Scientific, Illkirsch, France) Protein concentrations were measured using the Bradford method Luciferase activity was normalized as relative light units per lg of total protein in the supernatant The experiments were performed in triplicate Immunofluorescence Cellular uptake and subcellular localization of the FITClabelled hpST3dODN were analysed on cells grown on glass slides (Lab-Tek; Nunc, Rochester, NY, USA) Cells were washed twice in NaCl ⁄ Pi, fixed in 3.7% formaldehyde in NaCl ⁄ Pi for 15 min, permeabilized in 0.1% Triton X-100 for 15 and blocked with 5% FBS, 0.1% Tween in NaCl ⁄ Pi for h Cells were incubated with the primary antibody (anti-STAT3, anti-STAT1; Cell Signaling Technology, Beverly, MA, USA; dilution : 100) for h Alexa Fluor 546-labelled secondary anti-rat serum (InvitrogenMolecular Probes, Carlsbad, CA, USA) at : 250 was added for 90 After counterstaining with 4¢,6¢-diamidino-2-phenylindole, coverslips were mounted onto glass slides in Vectashield (Vectorlabs, Clinisciences, Montrouge, France) Fluorescence images were digitally acquired using a Zeiss Axioplan2 Deconvolution microscope (CarlZeiss, Le Pecq, France) and analysed with Metafer4 (Metasystems, Altlussheim, Germany) Oligodeoxynucleotide pull-down assays and western blotting Nuclear protein extracts were obtained as follows: 20 million cells were resuspended in lysis buffer (20 mm Hepes, pH 7.4, mm MgCl2, 10 mm KCl, 0.3% NP40, 0.5 mm dithiothreitol, 0.1 mm EDTA, protease inhibitors; CompeteÔ; Boehringer Ingelheim GmbH, Ingelheim Germany) at °C for The lysates were centrifuged at 14 000 g for at °C, and the supernatants containing the cytoplasmic proteins were discarded The pellets were resuspended in the cell lysis buffer adjusted with 20% glycerol and 0.35 m NaCl for 30 at °C After centrifugation at 14 000 g for at °C, the supernatants STAT3 hairpin decoy oligonucleotide cell killing were stored at )80 °C For pull-down assays, 100–200 lg of nuclear protein extracts were incubated for 30 at °C in binding buffer (1% NP40, 50 mm Hepes, pH 7.6, 140 mm NaCl) containing salmon sperm DNA (1 lg per assay) and lg of biotinylated hairpin decoy ODN or mutated control ODN The complexes were captured by incubation with 50 lL of avidin-sepharose beads (neutravidin; Pierce) for h at °C, washed three times with NaCl ⁄ Tris (20 mm NaCl, 500 mm Tris–HCl, pH 8), and once with NaCl ⁄ Tris-0.1% Tween After resuspension in sample buffer, complexes were separated on a SDS-polyacrylamide (10%) gel, and subjected to immunoblotting using anti-STAT3 (Cell Signaling Technology) Results were analysed by chemiluminescence (LumiGLO; Cell Signaling Technology) and autoradiography (X-Omat R; Eastman Kodak, Rochester, NY, USA) Acknowledgements A.T.H was supported in part by the Fondation Martine Midy This work was supported in part by grants from the Association de recherche contre le cancer (ARC, grant 3133) and RFBR 06-04-49196 References Benekli M, Baer MR, Baumann H & Wetzier M (2003) Signal transducer and activator of transcription proteins in leukemias Blood 101, 2940–2954 Zhong Z, Wen Z & Darnell JE Jr (1994) Stat3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6 Science 264, 95–98 Park OK, Schaefer TS & Nathans D (1996) In vitro activation of Stat3 by epidermal growth factor receptor kinase Proc Natl Acad Sci USA 93, 13704– 13708 Coffer PJ & Kruijer W (1995) EGF receptor deletions define a region specifically mediating STAT transcription factor activation Biochem Biophys Res Commun 210, 74–81 Shao H, Cheng HY, Cook RG & Tweardy DJ (2003) Identification and characterization of signal transducer and activator of transcription recruitment sites within the epidermal growth factor receptor Cancer Res 63, 3923–3930 Fujitani Y, Nakajima K, Kojima H, Nakae K, Takeda T & Hirano T (1994) Transcriptional activation of the IL-6 response element in the junB promoter is mediated by multiple Stat family proteins Biochem Biophys Res Commun 202, 1181–1187 Bromberg J & Darnell JE Jr (2000) The role of STATs in transcriptional control and their impact on cellular function Oncogene 19, 2468–2473 FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS 2513 STAT3 hairpin decoy oligonucleotide cell killing A Tadlaoui Hbibi et al Garcia R, Bowman TL, Niu G, Yu H, Minton S, Muro-cacho CA, Cox CE, Falcone R, Fairclough R, Parsons S et al (2001) Constitutive activation of Stat3 by the Src and JAK tyrosine kinases participates in growth regulation of human breast carcinoma cells Oncogene 20, 2499–2513 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated and supports cell survival in association with survivin expression in gastric cancer cells Oncogene 23, 4921–4929 10 Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C & Darnell JE (1999) STAT3 as an oncogene Cell 98, 295–303 11 Epling-Burnette PK, Zhong B, Bai F, Jiang K, Bailey RD, Garcia R, Jove R, Djeu JY, Loughran TP Jr & Wei S (2001) Cooperative regulation of Mcl-1 by Janus kinase ⁄ stat and phosphatidylinositol 3-kinase contribute to granulocyte-macrophage colony-stimulating factordelayed apoptosis in human neutrophils J Immunol 166, 7486–7495 12 Adachi Y, Aoki C, Yoshio-Hoshino N, Takayama K, Curiel DT & Nishimoto N (2006) Interleukin-6 induces both cell growth and VEGF production in malignant mesotheliomas Int J Cancer 119, 1303–1311 13 Wang T, Niu G, Kortylewski M, Burdelya L, Shain K, Zhang S, Bhattacharya R, Gabrilovich D, Heller R, Coppola D et al (2004) Regulation of the innate and adaptive immune responses by Stat-3 signaling in tumor cells Nat Med 10, 48–54 14 Grandis JR, Drenning SD, Zeng Q, Watkins SC, Melhem MF, Endo S, Johnson DE, Huang L, He Y & Kim JD (2000) Constitutive activation of Stat3 signaling abrogates apoptosis in squamous cell carcinogenesis in vivo Proc Natl Acad Sci USA 97, 4227–4232 15 Konnikova L, Kotecki M, Kruger MM & Cochran BH (2003) Knockdown of STAT3 expression by RNAi induces apoptosis in astrocytoma cells BMC Cancer 3, 23 16 Nagel-Wolfrum K, Buerger C, Wittig I, Butz K, Hoppe-Seyler F & Groner B (2004) The interaction of specific peptide aptamers with the DNA binding domain and the dimerization domain of the transcription factor Stat3 inhibits transactivation and induces apoptosis in tumor cells Mol Cancer Res 2, 170–182 17 Turkson J, Ryan D, Kim JS, Zhang Y, Chen Z, Haura E, Laudano A, Sebti S, Hamilton AD & Jove R (2001) Phosphotyrosyl peptides block Stat3-mediated DNA binding activity, gene regulation, and cell transformation J Biol Chem 276, 45443–45455 18 Leong PL, Andrews GA, Johnson DE, Dyer KF, Xi S, Mai JC, Robbins PD, Gadiparthi S, Burke NA, Watkins SF et al (2003) Targeted inhibition of Stat3 with a 2514 19 20 21 22 23 24 25 26 27 28 29 30 decoy oligonucleotide abrogates head and neck cancer cell growth Proc Natl Acad Sci USA 100, 4138–4143 Barton BE, Murphy TF, Shu P, Huang HF, Meyenhofer M & Barton A (2004) Novel single-stranded oligonucleotides that inhibit signal transducer and activator of transcription induce apoptosis in vitro and in vivo in prostate cancer cell lines Mol Cancer Ther 3, 1183–1191 Tomita T, Takano H, Tomita N, Morishita R, Kaneko M, Shi K, Takahi K, Nakase T, Kaneda Y, Yoshikawa H et al (2000) Transcription factor decoy for NFkappaB inhibits cytokine and adhesion molecule expressions in synovial cells derived from rheumatoid arthritis Rheumatology (Oxford) 39, 749–757 Nakamura H, Aoki M, Tamai K, Oishi M, Ogihara T, Kaneda Y & Morishita R (2002) Prevention and regression of atopic dermatitis by ointment containing NF-kB decoy oligodeoxynucleotides in NC ⁄ Nga atopic mouse model Gene Ther 9, 1221–1229 Liu X, Li J & Zhang J (2007) STAT3-decoy ODN inhibits cytokine autocrine of murine tumor cells Cell Mol Immunol 4, 309–313 Bromberg JF, Horvath CM, Wen Z, Schreiber RD & Darnell JE Jr (1996) Transcriptionally active Stat1 is required for the antiproliferative effects of both interferon alpha and interferon gamma Proc Natl Acad Sci USA 93, 7673–7678 Bromberg JF, Fan Z, Brown C, Mendelsohn J & Darnell JE Jr (1998) Epidermal growth factor-induced growth inhibition requires Stat1 activation Cell Growth Differ 9, 505–512 Chin YE, Kitagawa M, Kuida K, Flavell RA & Fu XY (1997) Activation of the STAT signaling pathway can cause expression of caspase and apoptosis Mol Cell Biol 17, 5328–5337 Lin Q, Lai R, Chirieac LR, Li C, Thomazy VA, Grammatikakis I, Rassidakis GZ, Zhang W, Fujio Y, Kunisada K et al (2005) Constitutive activation of JAK3 ⁄ STAT3 in colon carcinoma tumors and cell lines: inhibition of JAK3 ⁄ STAT3 signaling induces apoptosis and cell cycle arrest of colon carcinoma cells Am J Pathol 167, 969–980 Kunnumakkara AB, Anand P & Aggarwal BB (2008) Curcumin inhibits proliferation, invasion, angiogenesis and metastasis of different cancers through interaction with multiple cell signaling proteins Cancer Lett 269, 199–225 Lin JK (2007) Molecular targets of curcumin Adv Exp Med Biol 595, 227–243 Schust J, Sperl B, Hollis A, Mayer TU & Berg T (2006) Stattic: a small-molecule inhibitor of STAT3 activation and dimerization Chem Biol 13, 1235–1242 Laguillier C, Hbibi AT, Baran-Marszak F, Metelev V, Cao A, Cymbalista F, Bogdanov A Jr & Fagard R (2007) Cell death in NF-kappaB-dependent tumour cell lines as a result of NF-kappaB trapping by linker-modi- FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS A Tadlaoui Hbibi et al 31 32 33 34 35 36 37 fied hairpin decoy oligonucleotide FEBS Lett 581, 1143–1150 Geller J, Petak I, Szucs KS, Nagy K, Tillman DM & Houghton JA (2003) Interferon-gamma-induced sensitization of colon carcinomas to ZD9331 targets caspases, downstream of Fas, independent of mitochondrial signaling and the inhibitor of apoptosis survivin Clin Cancer Res 9, 6504–6515 Geller JI, Szekely-Szucs K, Petak I, Doyle B & Houghton JA (2004) P21Cip1 is a critical mediator of the cytotoxic action of thymidylate synthase inhibitors in colorectal carcinoma cells Cancer Res 64, 6296–6303 Bene A, Kurten RC & Chambers TC (2004) Subcellular localization as a limiting factor for utilization of decoy oligonucleotides Nucleic Acids Res 32, e142 Regis G, Pensa S, Boselli D, Novelli F & Poli V (2008) Ups & downs: The STAT1:STAT3 seesaw of Interferon and gp130 receptor signalling Semin Cell Dev Biol 19, 351–359 Holschermann H, Stadlbauer TH, Wagner AH, Fingerhuth H, Muth H, Rong S, Guler F, Tillmanns H & Hecker M (2006) STAT-1 and AP-1 decoy oligonucleotide therapy delays acute rejection and prolongs cardiac allograft survival Cardiovasc Res 71, 527–536 Stojanovic T, Scheele L, Wagner AH, Middel P, Bedke J, Lautenschlager I, Leister I, Panzner S & Hecker M (2007) STAT-1 decoy oligonucleotide improves microcirculation and reduces acute rejection in allogeneic rat small bowel transplants Gene Ther 14, 883–890 Huckel M, Schurigt U, Wagner AH, Stockigt R, Petrow PK, Thoss K, Gajda M, Henzgen S, Hecker M & Brauer R (2006) Attenuation of murine antigen-induced arthritis by treatment with a decoy oligodeoxynucleo- STAT3 hairpin decoy oligonucleotide cell killing 38 39 40 41 42 43 44 tide inhibiting signal transducer and activator of transcription-1 (STAT-1) Arthritis Res Ther 8, R17 Wagner AH, Wittjen I, Stojanovic T, Middel P, Meingassner JG & Hecker M (2008) Signal transducer and activator of transcription decoy oligodeoxynucleotide suppression of contact hypersensitivity J Allergy Clin Immunol 121, 158–165 Lui VW, Boehm AL, Koppikar P, Leeman RJ, Johnson D, Ogagan M, Childs E, Freilino M & Grandis JR (2007) Antiproliferative mechanisms of a transcription factor decoy targeting signal transducer and activator of transcription (STAT) 3: the role of STAT1 Mol Pharmacol 71, 1435–1443 Ozaki Y, Edelstein MP & Duch DS (1988) Induction of indoleamine 2,3-dioxygenase: a mechanism of the antitumor activity of interferon gamma Proc Natl Acad Sci USA 85, 1242–1246 Stephanou A (2004) Role of STAT-1 & STAT-3 in ischaemia ⁄ reperfusion injury Cell J Mol Med 8, 519–525 Hilfiker-Kleiner D, Hilfiker A & Drexler H (2005) Many good reasons to have STAT3 in the heart Pharmacol Ther 107, 131–137 Gariboldi MB, Ravizza R, Molteni R, Osella D, Gabano E & Monti E (2007) Inhibition of Stat3 increases doxorubicin sensitivity in a human metastatic breast cancer cell line Cancer Lett 258, 181–188 Albanese C, Johnson J, Watanabe G, Eklund N, Vu D, Arnold A & Pestell RG (1995) Transforming p21ras mutants and c-Ets-2 activate the cyclin D1 promoter through distinguishable regions J Biol Chem 270, 23589–23597 FEBS Journal 276 (2009) 2505–2515 ª 2009 The Authors Journal compilation ª 2009 FEBS 2515 ... transcriptional activity of STAT3 and colocalizes with STAT3 to the cytoplasm of SW480 cells The transcriptional activity of STAT3 after treatment of the cells with hpST3dODN was analysed in SW480 cells. .. Constitutive activation of JAK3 ⁄ STAT3 in colon carcinoma tumors and cell lines: inhibition of JAK3 ⁄ STAT3 signaling induces apoptosis and cell cycle arrest of colon carcinoma cells Am J Pathol 167,... Constitutive activation of Stat3 by the Src and JAK tyrosine kinases participates in growth regulation of human breast carcinoma cells Oncogene 20, 249 9–2 5 13 Kanda N, Seno H, Konda Y, Marusawa H, Kanai