0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Functional characterization of HGF and its receptor c met in zebrafish development

Functional characterization of HGF and its receptor c met in zebrafish development

Functional characterization of HGF and its receptor c met in zebrafish development

... paracrine signaling in liver development The coexpression of hgfa and c- met in pectoral fin, hgfb and c- met in proneprhic duct also indicate their paracrine signaling in the development of these ... Characterizing HGF and its receptor c- met s role in zebrafish development (Manuscript in preparation) v LIST OF FIGURES Fig.1.1 Schematic representation of proHGF/SF, HGF/ SF and the c- Met receptor ... X CHAPTER INTRODUCTION .1 1.1 Discovery of HGF and its receptor c- met 1.1.1 Discovery of HGF 1.1.2 Discovery of c- met and identification of c- met as the receptor...
  • 220
  • 498
  • 0
Báo cáo khóa học: Structural and functional comparison of 15S- and 15R-specific cyclooxygenases from the coral Plexaura homomalla potx

Báo cáo khóa học: Structural and functional comparison of 15S- and 15R-specific cyclooxygenases from the coral Plexaura homomalla potx

... confirmed the 15S-configuration of the endogenous PGs by Ó FEBS 2004 Comparison of coral 15S- and 15R -cyclooxygenases (Eur J Biochem 271) 3535 Fig Deduced amino acid sequence of the novel 15S-COX ... Val in the novel P homomalla 15S-COX and in all known 15S-specific COX proteins, and an Ile in the 15RCOX [22,31] To determine the role of residue 349 in the specificities of the two P homomalla ... substrate The Val349Ile mutant of the 15S-COX formed 65% PGF2a and 35% of the 15R-epimer of PGF2a In the case of the 15R-COX, the Ile349Val mutation caused a more pronounced effect on the stereochemistry...
  • 6
  • 414
  • 0
Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt

Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt

... designated P2Y12 [15–17] Results from our laboratory revealed that both classic P2Y1 and P2Y12 receptors coexist in glioma C6 cells: P2Y1, linked to phospholipase C, and P2Y12 , inhibiting adenylate ... and P2Y1 and P2Y12 receptor protein expression and functional activity Examination of the effects of specific pharmacological agents (a single agonist and two specific antagonists of P2Y1 and P2Y12 ... characterized by increased expression of the P2Y12 receptor and low expression of the P2Y1 receptor In cells grown in medium containing 10% (v ⁄ v) fetal bovine serum, the expression ratio of the two receptors...
  • 13
  • 378
  • 0
Báo cáo khoa học: Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis doc

Báo cáo khoa học: Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis doc

... organism for cloning the genes encoding the different fatty acid desaturases involved in EPA biosynthesis and identified two sequences coding for fatty acid desaturases with D5- and D6-regioselectivities ... contains 12 acidic amino acids (aspartate and glutamate), whereas the corresponding domain sequences in PtD5p and PtD6p have only eight and five acidic residues, respectively Such a decrease in ... the number of acidic amino acids in fused cytochrome b5 domains has been observed in Fig Amino acid sequences of PtD5p and PtD6p For alignment the CLUSTAL X program was used (gap opening 12, gap...
  • 9
  • 455
  • 0
Báo cáo y học:

Báo cáo y học: "Structural and functional characterization of human apolipoprotein E 72-166 peptides in both aqueous and lipid environments" pot

... concentration of DHPC Protein -lipid interactions and Protein-LDLR binding of ApoE- (72-166) Proteins To identify and compare the lipid binding ability of the three apoE- (72-166) peptides, we assessed ... Received: 17 September 2010 Accepted: 10 January 2011 Published: 10 January 2011 References Weisgraber KH, Rall SC Jr, Mahley RW: Human E apoprotein heterogeneity Cysteine-arginine interchanges ... apoE3 and apoE4, and with apoE2-, apoE3-, and apoE4- (72-166) proteins, respectively The VLDL bands were shifted with the binding of apoE proteins Detailed procedures are described in Materials and...
  • 9
  • 333
  • 0
báo cáo khoa học:

báo cáo khoa học: " Isolation and functional characterization of a cDNA coding a hydroxycinnamoyltransferase involved in phenylpropanoid biosynthesis in Cynara cardunculus L" potx

... 5'-ATGGCAACACTGTCAATTA-3' 5'-CCCGACGATCAGGATA-3' 5'-ACCGCCGGGATGAGTT-3' 5'-CCGCCTCCACGAACAA-3' 5'-TTCCGTTTCGTTTCTTCAA-3' 5'-TGGCCATAACCATTTTAGATAT-3' 5'-GGGTTTCATATGAAGATCGAGGTGAGAGAA-3' 5'-CGGGATCCTTAGATATCATATAGGAACTTGC-3' ... N-hydroxycinnamoyl/benzoyltransferase from I batatas (AB035183); AtHCT, shikimate/quinate hydroxycinnamoyltransferase of A thaliana (At5g48930); NtHCT, shikimate/ quinate hydroxycinnamoyltransferase of N tabacum (AJ507825); ... hydroxycinnamoyl CoA quinate transferase of N tabacum (CAE46932); LeHQT, hydroxycinnamoyl CoA quinate transferase of L esculentum (CAE46933); At2G19070 and At5G57840, A thaliana genes encoding putative...
  • 14
  • 535
  • 0
Cellular and molecular control of skeleton formation in fish  insights from osteoblast ablation and functional characterization of lrp5 and SOst

Cellular and molecular control of skeleton formation in fish insights from osteoblast ablation and functional characterization of lrp5 and SOst

...  51   3.2 FUNCTIONAL CHARACTERIZATION OF LRP5 AND  ITS  PUTATIVE  INHIBITOR SOST  DURING   CRANIOFACIAL SKELETON FORMATION    53   3.2.1 Lrp5 and Sost  are  conserved ...  EXPRESSION OF LRP5 AND  ITS  PUTATIVE  INHIBITOR SOST  DURING  CRANIAL   SKELETON  DEVELOPMENT IN  ZEBRAFISH    84   4.3  A  ROLE  FOR LRP5 AND SOST IN  MORPHOGENESIS OF  THE ...  Complementary and  overlapping  expression of Lrp5 and  its  putative  inhibitor Sost   during  cranial skeleton  development in  zebrafish    55   3.2.3 sost  but  not lrp5  expression...
  • 111
  • 368
  • 0
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf

Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf

... allows the functional expression of a variety of single mitochondrial- type AACs in E coli After IPTG-induction we were able to obtain functional integration of the various mitochondrial- type AACs into ... into the cytoplasmic membrane of E coli Measuring the uptake of the various adenylates into intact E coli cells expressing eukaryotic AACs, we were able to determine the biochemical properties of ... proteins The membrane fractions of the induced E coli cells were isolated and the recombinant AAC proteins were further purified by Ni-nitrilotriacetic acid chromatograpy The autoradiography of the...
  • 10
  • 486
  • 0
Báo cáo khoa học: Membrane trafficking of CD98 and its ligand galectin 3 in BeWo cells ) implication for placental cell fusion pot

Báo cáo khoa học: Membrane trafficking of CD98 and its ligand galectin 3 in BeWo cells ) implication for placental cell fusion pot

... cytoplasm and in the nucleus of forskolin-treated BeWo cells Inhibition of galectin binding to membrane glycoproteins affects cellular fusion We then investigated whether the close proximity of CD98 and ... Probes, Invitrogen, Paisley, UK) per 106 cells mL)1 cells for 30 min, or with MitoTracker Deep Red 633 (Molecular Probes) at a concentration of 25 nm per 106 cells mL)1 cells for 15 min; labeling ... (200 2) New alternatively spliced form of galectin 3, a member of the beta-galactoside-binding animal lectin 2726 27 28 29 30 31 32 33 34 35 36 family, contains a predicted transmembrane-spanning...
  • 13
  • 385
  • 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...
  • 12
  • 561
  • 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the northeastern coast of Newfoundland on ... staining when CaCl2 is added to the staining and washing buffer (Fig 1) Measurement of antifreeze activity Antifreeze activity was measured on equimolar amounts of deglycosylated and untreated...
  • 8
  • 518
  • 0
Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

Báo cáo khóa học: Purification and functional characterization of insecticidal sphingomyelinase C produced by Bacillus cereus ppt

... expression of the insecticidal toxin (SMC) in E coli The SMC gene amplified by PCR using the vector sense (VS) (5¢-GGGAATTCCATATGGAAGTGTCTACAA ATC-3¢) and vector antisense (VA) (5¢-CCGCTCG AGCTTCATAGAAATAGTCGCCTC-3¢) ... The bacteria-free supernatant was tested for its insecticidal activity against the cockroaches by injection Identification of B cereus To identify the bacterial species producing insecticidal ... phospholipase C of B cereus, which is not absorbed by DEAE-cellulose resin, showed insecticidal activity [6,7] Thus, to obtain other insecticidal factors, we decided to purify the insecticidal factors...
  • 6
  • 456
  • 0
Báo cáo y học:

Báo cáo y học: "Functional significance of nerve growth factor and its receptor (TrkA) in inflammatory arthritis" pps

... to in uence the in ammatory and proliferative cascades of PsA and RA Abbreviations ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocyte; NGF, nerve growth factor; NGF-R, nerve ... expression in rheumatoid arthritis and spondyloarthritis Arthritis Res Ther 2009, 11:R82 Raychaudhuri SP, Raychaudhuri SK: The regulatory role of nerve growth factor and its receptor system in fibroblast-like ... proliferating FLSs produce proteinases that degrade cartilage and underlying cortical bone [4] We noticed that proinflammatory cytokines upregulate NGF/TrkA in FLSs, NGF/TrkA is upregulated in FLSs of in ammatory...
  • 2
  • 264
  • 0
Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

Discovery of botanical flavonoids as dual peroxisome proliforator, activated receptor (PPAR) ligands and functional characterization of a natural PPAR polymorphism that enhances interaction with nuclear compressor

... 3.2 Characterization of flavonoids on PPAR and PPAR activity 103 3.3 Characterization of flavonoids and PPAR ligands on a natural PPAR V22 7A variant 124 3.4 Mechanism(s) elucidation of attenuated ... their clinical application especially in patients with heart failure (Arakawa et al 2004; Rangwala and Lazar 2004; Staels 2005) 1.3.2 Dual PPAR /PPAR ligands In general, diabetic patients suffer ... Comparisons of activity ratios between natural and synthetic dual PPAR /PPAR dual agonists 180 Table 4.3 Summary of coregulator interaction of PPAR 195 Table 4.4 Summary of corepressor interaction...
  • 263
  • 267
  • 0

Xem thêm

Từ khóa: the biology of cancer and its relationship to disparities in cancer occurrence and outcomesthe discovery of vegf c and its receptor vegfr 3isolation and characterization of acetyl coa carboxylase from c crypticaout of the green yonder molecular cloning and functional characterization of beta carotene 15 15 apos oxygenasesdetection and characterization of the t cell receptor repertoireidentification and functional characterization of srnas in neisseria meningitidispurification reconstitution and functional characterization of zinc transporter from rat renal brush border membranesmolecular and functional characterization of p glycoprotein in vitrocharacteristics of obesity and its related disorders in chinaexcretion of cocaine and its metabolites in mandetection of cocaine and its metabolites in breast milkdetection of cocaine and its metabolitesdesign of lvdt and its signal conditioning circuitoxidative stress in cardiovascular diseases and obesity role of p66shc and protein kinase chistory of biotechnology and its relevance to societyBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)