Label free electrochemical DNA and protein detection using ruthenium complexes and functional polyethylenedioxythiophenes
Label free electrochemical DNA and protein detection using ruthenium complexes and functional polyethylenedioxythiophenes
... we studied label- free electrochemical DNA detection using ruthenium- complexed intercalators Two ruthenium- complexed electroactive DNA intercalators were synthesized, characterized, and their application ... drawbacks, label- free bioaffinity sensors are intensively investigated Label- free approach is becoming a more favored choice due to its simple and rapid analysis Electrochemical detection Label- free detection ... discuss ruthenium- based redox active compounds and their application for label- free DNA sensing Chapter two presents two ruthenium- based electroactive intercalators for label- free DNA detection, ...
- 157
- 591
- 0
Label free electrochemical immunoaffinity sensor based on impedimetric method for pesticide detection
... Electrochemical Immunoaffinity Sensor for Pesticide Detection TOPICAL CLUSTER In the present study, we describe an innovative strategy based on an original electrogenerated polyquinone film ... related to ATZ For CPEef, changes to ATD represents only 34 % of the one obtained for ATZ, at 10 nM ATD As expected, the selectivity is lower for high concentrations than for low concentrations Fig ... individually to determine ATZ in solution, for concentration as low as 0.2 pg mLÀ1 Fig Schematic representation of the ion flux, before and after complexation and decomplexation Experimental 2.1 Chemicals...
- 7
- 346
- 0
Electrochemical DNA sensor for detection of environmental pathogens
... technique of DNA detection require minimal sample preparation step for analyte detection and show very low detection limit Among non pcr based DNA detection, the focus of the study is only based on electrochemical ... sensitive electrochemical impedimetric DNA biosensor for detection of even single nucleotide mismatches [24] In this method EIS was used to study the electrochemical behaviour of probe ss DNA attached ... nm for the detection of whole virus particle [73] and E coli cells [74] More recently, the same nanoporous alumina membrane nanobiosensor has been extended for the detection of ssDNA target of...
- 194
- 490
- 0
Label free and reagentless electrochemical detection of microRNAs using a conducting polymer nanostructured by carbon nanotubes application to prostate cancer biomarker mir 141
... NH2–CCATCTTTACCAGACAGTGTTA 3′ 3′ GGUAGAAAUGGUCUGUCACAAU 5′ 3′ UUGUGACUAAAGUUUACCACGAU 5′ 3′AGUAUC GGGACAUGUUACGACGA 5′ 166 H.V Tran et al / Biosensors and Bioelectronics 49 (2013) 164–169 2.5 Grafting ... formats (Xu et al., 2004, 2006; Cai et al., 2003) In this paper, we describe a label- free and reagentless miRNA sensor based on an interpenetrated network of carbon nanotubes and electroactive polymer ... works were related to label- free and reagentless biosensors Okuno et al (2007) described a label- free and reagentless immunosensor for prostate- specific antigen based on singlewalled CNT-modified...
- 6
- 298
- 0
Multi wall carbon nanotubes (MWCNTs) doped polypyrrole DNA biosensor for label free detection of genetically modified organisms by QCM and EIS
... screening in DNA detection approach (this approach is more often used than the second one of protein detection because DNA stability is much higher than that of proteins and therefore DNA detection ... study, we described the setup of a novel DNA label- free electrochemical biosensor for GMO (soybean) detection, based on MWCNT -doped PPy matrices for ODN immobilization and hybridization Experimental ... electropolymerization of C-PPy-ODN film Results and discussion 3.1 Film formation and morphology Normally, sensitivity and reproductibility of DNA sensors are determined by the surface chemistry of the recognition...
- 6
- 275
- 2
Báo cáo khoa học: Emerging tools for real-time label-free detection of interactions on functional protein microarrays ppt
... technologies for the real-time label-free detection and characterization of protein interactions that may provide higher resolution functional data Common methods for studying protein interactions Current ... protein interactions with nonprotein biomolecules will depend on the development of labelfree methods for measuring the interactions Coupling functional protein microarrays to real-time label-free detection ... Sensitivity and detection limit will govern the lowest concentration of an analyte that can be detected Label-free detection for protein microarrays sources of nonspecific binding for protein arrays:...
- 14
- 551
- 0
báo cáo khoa học: "A signal amplification assay for HSV type 1 viral DNA detection using nanoparticles and direct acoustic profiling" ppsx
... of signal, the detection limit obtained for the VP16 probe was 5.2 × 10 -11 M When the semi-homogeneous and homogeneous assay formats were compared experimentally for detection of 5.2 × 10 -10 ... gold nanoparticles in ml solution used for modification* NA capacity of each nanoparticle when excess NA molecules used 6.02 × 10 13 15 1. 4 × 10 12 23 6.02 × 10 13 6.02 × 10 13 40 60 8.9 × 10 10 2.6 ... the amplification of gold nanoparticles using quartz crystal microbalance Nanotechnology 2007, doi :10 .11 86 /14 77- 315 5-8-3 Cite this article as: Uludağ et al.: A signal amplification assay for HSV...
- 12
- 394
- 0
Development of protein microarrays and label free microfluidic immunoassays
... DEVELOPMENT OF PROTEIN MICROARRAYS AND LABEL- FREE MICROFLUIDIC IMMUNOASSAYS XUE CHANGYING (CHEM ENG., DUT) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CHEMICAL ... protein microarrays and label- free microfluidic immunoassays with high stability, high sensitivity, fast response and low sample consumption, which can facilitate the development of low-cost and ... number of proteins simultaneously such as fast profiling of disease-related proteins and screening protein- protein interactions This advancement greatly accelerates the application of immunoassays...
- 203
- 341
- 0
Báo cáo y học: "Parvovirus B19 Nonstructural Protein-Induced Damage of Cellular DNA and Resultant Apoptosis"
... single-strand break DNA repair pathway if applied to host cell DNA This pathway was investigated by studying the activity of Poly(ADP-ribose)Polymerase (PARP), the protein which detects nicks in DNA and ... principally binds to free DNA ends or DNA strand breaks (43), while ATR recognizes single-stranded regions of DNA common to multiple types of DNA lesions and that are often caused by collapsed ... range of values Discussion This work identifies several lines of evidence indicating that NS1 damages cellular DNA, and that this damage leads to apoptosis Upon detection of DNA damage, DNA damage...
- 9
- 469
- 1
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt
... protein arginine methyltransferase and toward the Ewing sarcoma protein and a peptide Proteins 61, 164–175 48 Raman B, Guarnaccia C, Nadassy K, Zakhariev S, Pintar A, Zanuttin F, Frigyes D, Acatrinei ... 4) and 32P-labeled ETS-1 (lanes and 4) or ssDNA L (lanes and 2) (B) EMSA was performed with EWS (lanes 2, and 6) and 32P-labeled Htelo (lanes and 4), dsHtelo (lanes and 6) or ssDNA S (lanes and ... ACA G) and EWS reverse d(CGC TCG AGT CAC TAG TAG GGC CGA TCT CTG C), for pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC...
- 11
- 786
- 0
Tài liệu Báo cáo khoa học: "Finding Hedges by Chasing Weasels: Hedge Detection Using Wikipedia Tags and Shallow Linguistic Features" doc
... Computational Linguistics, 22(2):249–254 Hyland, Ken (1998) Hedging in scientific research articles Amsterdam, The Netherlands: John Benjamins Lakoff, George (1973) Hedges: A study in meaning criteria and ... covers the entire Wikipedia and thus as many domains as are in Wikipedia Acknowledgments This work has been partially funded by the European Union under the project Judicial Management by Digital Libraries ... edited This implies that weasel tags are short lived, very sparse and that – because weasels may not have been discovered yet – not all occurrences of linguistic hedges are tagged Therefore we...
- 4
- 451
- 0
Báo cáo khoa học: Fluorescence quenching and kinetic studies of conformational changes induced by DNA and cAMP binding to cAMP receptor protein from Escherichia coli ppt
... uorescence studies of conformational changes induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from Escherichia coli Eur J Biochem 270, 14131423 Yu S & Lee JC (2004) Role of residue ... changes induced by DNA and cAMP 19 20 21 22 23 24 25 26 27 28 29 30 31 cAMP -induced allosteric changes in T127I, S128A and T127I S128A mutants of cAMP receptor protein from Escherichia coli J ... CRP conformational changes induced by DNA and cAMP i.e free CRP, CRP (cAMP) 2 and CRP (cAMP) 4 In the presence of % 100 lm cAMP, the protein becomes activated by the formation of a CRP (cAMP) 2...
- 14
- 400
- 0
Báo cáo khoa học: Solution structure and backbone dynamics of the XPC-binding domain of the human DNA repair protein hHR23B docx
... 2A) The N-terminal part of XPCB hHR23B B C Fig NMR structure of the XPCB domain of hHR23B (A) Stereoview of the 12 superimposed structures of XPCB hHR23B All Pro residues conserved among the ... further our knowledge with respect to the mechanisms of action of these proteins, it is crucial that we define the precise boundaries of the STI1-homologous domain and compare the structures of these ... 2467–2476 ª 2005 FEBS Dynamic structure of XPC-binding domain of hHR23B Experimental procedures Cloning and purification of the XPCB hHR23B domain The cDNAs encoding the hHR23B were generously provided...
- 10
- 431
- 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
- 9
- 444
- 0
Từ khóa: transcription and splicing e protein coding in dna and rnaprotein coding in dna and rnagenetic manipulation of dna and protein examples from current researchextraction of dna from viral particles using formamide and ctab nacldna rna protein and gene expression60 hz hum eliminator and heart rate detection using electrocardiographydna and oligonucleotide delivery using chitosan as complexing agentdetection using histology and immunohistochemistryidentification and optimization of dna aptamer binding regions using dna microarrayslabel free detection with surface plasmon resonance imagingdesorption ionization mass spectrometry for protein identification using peptide and fragment ion massescisplatin arsenic and hyperthermia on dna repair protein expressionparameters dna integrity protein profile and phosphorylation state of proteins of seawater fish spermatozoadna recombinant protein and xiap induce higher level of cd8 t cell immune responsesstep 1 data acquisition and standard data processing arrays were scanned for fluorescence signal detection using the genepix 4000b axon scanner molecular devices ca and the generated images were aNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI