tumor host interactions at the metastatic site mkk4 signal transduction and the stress response
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... Vps4p is regulated by ATP binding rather than hydrolysis, and interaction of Did2p with Vps4p is regulated by neither ATP binding nor ATP hydrolysis Our data highlight the fact that the role of ... by the b domain In addition, mutation of the b domain strengthens interactions with the MIT domain Thus our data offer the first evidence that there may be functional interactions between the...
- 14
- 362
- 0
Báo cáo hóa học: " Stretching and immobilization of DNA for studies of protein–DNA interactions at the single-molecule level" ppt
... during the synthesis and show a decrease in the replication rate when the force exceeds pN The decrease in the replication rate is attributed to the work that DNAP has to perform against the external ... of the DNA; then the DNA molecule is stretched out by the force exerted on the rest of the DNA by the receding meniscus; and finally the other end also sticks to the substrate as it dries The ... attachment to the gold electrode After immobilization the DNA molecules were stretched and anchored at the other end using a MHz field The stretching that occurred at MHz might have arisen either...
- 17
- 351
- 0
Estrogen receptor a mediated long rang chromatin interactions at the ret gene locus in breast cancer
... overnight Then µl of the 10× ligation buffer and µl of the ligase was added into the tube to ligate the fragments The tube was incubated at 16 ℃ for hours then left at room temperature for hour The ... approximately the cells were then washed from the surface of the flask with ml of the passage medium and then pipette up and down repeatedly to obtain single cell suspension The MCF7 cells were then ... to the dependence on ligand activated ERα, these recent data indicates a key role of ERα in the mediation of long range chromatin interactions 11 Using the ChIA-PET assay, a genome-wide chromatin...
- 90
- 412
- 0
Báo cáo khoa học: The crystal structure of annexin Gh1 from Gossypium hirsutum reveals an unusual S3 cluster Implications for cellulose synthase complex formation and oxidative stress response potx
... between ˚ and 2.1 A Data processing was carried out with the programs DENZO and SCALEPACK [21] and the data collection statistics are summarized in Table The diffraction pattern indicated a trigonal ... as a template for canonical calcium binding immediately shows that binding sites in domains II, III and IV are either distorted or the access of a cation to the site is blocked by the presence ... groove on the convex side (cf Figure 1B) Located at the entrance of the groove between domains III and IV is a U-shaped, positively charged patch The patch is formed by five lysine and three arginine...
- 8
- 475
- 0
Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx
... expression in the NI after h of restrained stress The upper panel shows a representative image of in situ hybridization using the [35S]-labeled probe The graph below indicates the calculated signal ... of the periaqueductal gray matter and the other is in a posterior region that could be homologous to the mammalian NI [25] Two groups have described the distribution of relaxin-3 in the primate ... number of these neurons are A 4V DTg NIc NId scattered in the pontine raphe nucleus, the periaqueductal gray matter, and the area dorsal to the substantia nigra in the midbrain reticular formation...
- 8
- 369
- 0
Báo cáo y học: "Stress, the stress response system, and fibromyalgia" ppt
... fact that the heart rate is not fixed, but varies from beat to beat constantly The antagonistic effects of the sympathetic and parasympathetic branches of the ANS on the sinus node harmonize the ... with the fact that blocking the efferent sympathetic supply to the affected region relieves the pain, and with the observation that norepinephrine injections rekindle the pain The sympathetically ... microelectrodes placed at the peroneal nerve level They found no exaggerated sympathetic activity in FM subjects; nevertheless, these patients displayed less pronounced sympathetic activity as a response to...
- 7
- 301
- 0
Báo cáo y học: "Is fibromyalgia a cardiovascular disease? A comment on Martinez-Lavin’s review ‘Stress, the stress response system, and fibromyalgia’" ppsx
... Martinez-Lavin M: Biology and therapy of fibromyalgia: Stress, the stress response system, and fibromyalgia Arthritis Res Ther 2007, 9:216 Fontenele JB, Félix FHC: Fibromyalgia and related medically unexplained ... Arthritis Research & Therapy Vol No Félix and Fontenele Competing interests The authors cite their own work on the subject that is currently in press There are no potential sources ... and nociception modulation? J Musculoskeletal Pain, in press Stewart J, Taneja I, Medow MS: Reduced central blood volume and cardiac output, and increased vascular resistance during static handgrip...
- 2
- 224
- 0
Báo cáo y học: "The organisation of the stress response, and its relevance to chiropractors: a commentary" pdf
... and output pathways As there are multiple brain structures concerned in the organization of the stress response, these systems are intricately related A schematic representation of the stress system ... tubules of the kidneys Implications of the stress response on the body Everyday interactions with the environment inevitably expose the body to a wide range of stressful stimuli The stress response ... literature is the notion that the prolonged activation of these reflexes will manifest into pathological state of tissues, and most relevantly, that the application of spinal manipulative therapy can...
- 13
- 382
- 0
Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"
... method that treats both the fracture and the infection (Figure 8) At the time of prosthesis reimplantation, the spacer head can be easily removed and the modular prosthesis parts (neck and head) ... femoral fixation of hip spacers [3] This method provides a stable fixation onto the proximal femur at facilitating the spacer’s explantation since the spacer can be removed at one piece and there ... lag screws and Charnley prostheses, respectively [5] The authors reported that all constructs based upon the Charnley prostheses and the commercial spacers did not fail at 3000 N; the other two...
- 6
- 455
- 0
Tài liệu Báo cáo khoa học: Site-directed mutagenesis of a loop at the active site of E1 (a2b2) of the pyruvate dehydrogenase complex A possible common sequence motif docx
... substrate and that E1aTyr281 and, to a lesser extent, E1aAsp276 and E1aArg282, have some effect on the decarboxylation of pyruvate and the reductive acetylation of the tethered lipoyl domain in the ... despite the fact that the Km is c 20 lM [37,38] Another difference in the assays is the concentration of the substrate, pyruvate The different types of assay are reflected in the different rates; the ... acetylation of the tethered lipoyl domain in the assembled PDH complex It should be noted that Tyr281 and Arg282 are located at the mouth of the funnel-shaped active site of E1, at the bottom of...
- 10
- 459
- 0
Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc
... motion was further indicated by the dyndom algorithm [30], with the coordinates obtained for the ligand-free form and the hGK–ATP complex at the end of the simulations (Figs 6B,C and S3; Table ... simulations of the modelled binary GK–ATP complex revealed that the global rmsd of the structure converged at the end of the 2-ns simulation period (Fig S2A) The dynamic changes in the active site ... The ATP-binding site in the MD simulated model structure of the binary hGK–ATP complex and the domain motion induced by ATP binding to the hGK apoenzyme (A) Close-up view of the ATPbinding site...
- 15
- 374
- 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... The above results showed that purified GST–HIPPI interacted with the bp motif AAAGACATG present at the upstream sequence () 101 to ) 93) of the caspase-1 gene, and that mutation at the sixth and ... shown in Fig 3, and indicates that mutation of the specific site of the binding motif at the putative promoter sequence of the caspase-1 gene, where HIPPI can bind, decreased the FEBS Journal ... USA) at 37 °C in 5% CO2 atmosphere under humidified conditions (P8), and AAAGACATA (P9), and their complementary sequences CATGTCTCT (P2C), CATGTCCTT (P3C), CATGTATTT (P4C), CATGGCTTT (P5C), CATCTCTTT...
- 14
- 393
- 0
Báo cáo khoa học: Site-directed mutagenesis of selected residues at the active site of aryl-alcohol oxidase, an H2O2-producing ligninolytic enzyme pot
... absorption maxima at 387 and 463 nm, indicating that the cofactor was in the oxidized state and correctly incorporated The absorption maxima of L315A were situated at 372 and 459 nm, and the shoulder ... sodium phosphate, pH 6.0, at 24°C) Benzyl alcohol Wild-type Km kcat kcat ⁄ Km Y78A Km kcat kcat ⁄ Km Y92F Km kcat kcat ⁄ Km L315A Km kcat kcat ⁄ Km F501A Km kcat kcat ⁄ Km F501Y Km kcat kcat ⁄ Km ... where A is the maximal turnover rate (kcat), X is the substrate concentration, K is the Michaelis constant (Km), and B is the catalytic efficiency (kcat ⁄ Km) Mean and standard deviations were...
- 11
- 471
- 0
Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence specific DNA binding proteins pptx
... residue at 16 295 of the genome The 22-bp nucleotide sequence (16 274-5¢-ATTACGCAATAAAC ATTAACAA-3¢-16 295) containing the mouse mt H strand transcription start site and also the putative termination ... Mut1 with both complexes These results show that the putative polyadenylation signal AATAAA, and also the sequences upstream and downstream of the canonical polyadenylation signal are important for ... leupeptin, pepstatin and antipain and 25 lg poly dI-dC The binding mixture was incubated for 60 at °C on a rotating wheel The contents were then poured into a 0.6 · cm column and the unbound material...
- 13
- 415
- 0
Báo cáo khoa học: Auto-methylation of the mouse DNA-(cytosine C5)-methyltransferase Dnmt3a at its active site cysteine residue pot
... The formation of the cysteine–cytosine bond increases the negative charge density at the C5 atom of the cytosine, which then attacks the methyl group bound to AdoMet Base flipping and the nucleophilic ... type The distance between the sulfhydryl atom of the catalytic cysteine side chain and sulfur ˚ atom of AdoHcy (7.66 A) is indicated On the other hand, they harbor a cysteine residue in their ... could stimulate Dnmt3a for auto-methylation and therefore inactivation On the other hand, the auto-methylation of Dnmt3a and other MTases may simply be a side reaction caused by the high methyl...
- 9
- 437
- 0
Báo cáo khoa học: Carbohydrate binding sites in Candida albicans exo-b-1,3-glucanase and the role of the Phe-Phe ‘clamp’ at the active site entrance ppt
... network of interactions that hold the terminal glucose of the bglucan substrate in the )1 subsite at the bottom of the active site pocket [20] The entrance to the active site pocket of Exg is flanked ... bound to the active site (subsites )1, +1 and +2) and another to the remote site at which two ordered glucose residues were seen ˚ each other and only A apart, but also involved in substrate specificity ... towards aromatic triads that can accommodate the twists specifically associated with b-1,3-glucan polymers The nature of the aromatic residues in the two triads might then be reflecting the different...
- 13
- 498
- 0
Báo cáo khoa học: Low U1 snRNP dependence at the NF1 exon 29 donor splice site doc
... New site New site New site New site New site New site New site Site broken Site broken New site New site New site New site New site Site broken New site Site broken New site Site broken Site ... New site Site broken New site New site Site broken Site broken Site broken Site broken Site broken Site broken New site Site broken New site New site New site Site broken Site broken New site Site ... the following oligonucleotides: NF29-F, 5¢-ttcattcatatgaccatttgaatatacaatggt-3¢; and NF29-R, 5¢-aagtaacatatgatggagaaaggacatatat-3¢ Both oligonucleotides carry an Nde1 site in their 5¢-ends, and...
- 14
- 206
- 0
Báo cáo khoa học: Do N-terminal nucleophile hydrolases indeed have a single amino acid catalytic center? Supporting amino acid residues at the active site of penicillin G acylase pptx
... with the substituent on the amino moiety of the substrate, confirming that the formation of acyl enzyme (AE) is the rate-limiting step of the reaction The Hammett plot of log(kcat,R ⁄ kcat,H) ... phenylmethanesulfonyl-SerB1 derivative These structures are mimics of the stationary points along the reaction pathway; they depict the changes in the spatial structure of the active site during catalysis Phenylacetic ... another point of view, the hydrogen bond between the oxyanion and the aNH3+ of SerB1 resembles the one between the carboxylate group of the Asp residue and the protonated imidazole ring of the...
- 10
- 425
- 0
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
... subunitặmm)2) at saturation [26] Effect of active site ligands on the rate of phosphorylation of recombinant hPAH H4biopterin and L-Phe have been shown to inhibit and stimulate, respectively, the rate ... onto the structure of the ligandfree rPAH (containing the regulatory and catalytic domains) [19] revealed that both the reduced and the oxidized cofactor interact with the N-terminal autoregulatory ... conformational states (isomers) of the enzyme The four conformational states include a ground state for the ligand-free enzyme, an activated state with bound substrate (L-Phe), an inhibited state...
- 10
- 470
- 0
Báo cáo Y học: Propionate CoA-transferase from Clostridium propionicum Cloning of the gene and identi®cation of glutamate 324 at the active site pdf
... and acetate (200 mM) at 25 °C Note that the activity in the cell free extract is the sum of CoA-transferase and phosphotransacetylase and that the latter enzyme is completely separated from the ... glutamate 324, which led us to conclude that this residue is the active site carboxylate The proteins most similar to propionate CoA-transferase in the databases are a putative acetoacetate CoAtransferase ... unequivocal identi®cation of the catalytic glutamate of propionate CoAtransferase, this residue was speci®cally labelled The thiol ester in the proposed enzyme-CoA intermediate of the CoAtransferase...
- 9
- 498
- 0
- the role of positive facial feedback in the stress response
- protein synthesis and the stress response
- enthalpy of noncovalent interactions at the carboxylate moieties of the ligand
- to study allelochemical interactions at the molecular level
- controlling and assessing cell biomaterial interactions at the micro and nanoscale applications in tissue engineering
- cell biomaterial interactions at the micro and nanoscale
- stress health and disease the physiology and pathophysiology of stress and the stress response
- sns stress and the stress response
- protein lipid interactions at the interface
- protein lipid interactions at the oil aqueous interface
- dynamic nature of tumour host interactions within the tumor microenvironment
- stress the stress response and the impact on immunity
- overview of the stress response system
- rodent stressors and the stress response
- aberrant glycosphingolipid expression and membrane organization in tumor cells consequences on tumor host interactions
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25