... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... the absorbance measured at increasing concentrations of ligand, KD is the dissociation constant, c is the concentration of ligand, biotinylated b-DG(654–750), and Asat and A0 are the absorbances...
... division of xn by the instance, one has that a0 n characteristic polynomial ofA Further, by elementary techniques of linear algebra one can also compute them in terms ofthe eigenvalues ofA an approach ... system andthe description ofthe Advances in Difference Equations dynamics in the general case β2 / We finish the paper by describing thedynamics in the particular case where the coefficients andthe ... λ2 /λ and λ3 /λ The result is trivial when β2 since the eigenvalues √ √ ofA are β1 and ± α2 and fixed points are always associated to one ofthe eigenvalues ± α2 λ2 − α2 /β2 and y∗ λ and, therefore,...
... between the LAI and both climatic and soil factors; (2) understand how the water and carbon balances behave as a function of water availability and LAI; and (3) define how the balance between LAI and ... 154 C Hoff and S Rambal fall and leaf quantity [33, 43] Important then are the timing of rainfall and drought events, the quantity of rainfall, the storage capacity ofthe soil and quantity and ... has a dual time step Water and most ofthe carbon variables are calculated on a daily basis, whereas nitrogen and carbon pools are updated each year The model requires daily climate input data:...
... Sulawesis and Minangkabaus from Sumatra They spoke different varieties of Malay Munshi Abdullah in his travel accounts contrasts the ‘pure Malay language’ (Andaya & Andaya 119) spoken in the state ... ofthe characters The mode of first-person narration on the other hand demands the characteristics ofthe spoken rather than the written word, where the vocabulary and syntax characteristic of ... School in Seramban Andthe first Malay College, an English-medium school, was opened in 1905 at Kuala Kangsar, and only Malay children of good birth” (Andaya & Andaya 228) andthe brightest...
... density The structures ofthe various minima, and their relative energies, allow a detailed comparison ofthe competitive strengths of each type of interaction, and an identification of any that might ... noncovalent interactions, but the E(2) values of all of them are only around 0.52 kcal mol1 The comparison ofthe complexes of NMA with CH3SH and CH3SCH3 indicates that the loss ofthe possibility of an ... U Adhikari and S Scheiner p*(CO) interaction, as many ofthe other structures Another minimum, 0.2 kcal mol1 higher than the first, adds another pair of charge transfers, both into the SS s* antibonding...
... 30m, the same resolution as the Landsat images The thermal band ofthe TM image was resampled to 60m, the same as the ETM+ image 33 4.2.3 Land use classification system The selection ofthe land ... directional landscape analyses along with landscape metrics were first used to characterize landscape patterns Change intensities ofthe landscape patterns were then calculated for the study area as a ... 1999 As the main passage from China to most ofthe countries in Southeast Asia, such as Vietnam, Laos, Thailand, and Cambodia, andthe traffic hubs ofthe Mekong regional economic cooperation...
... Trinidad and Tobago, Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside the subregion, ... subregion, and; CDB in Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St Kitts and Nevis, St Lucia, St ... and suppliers; ***Paris Club countries are Australia, Austria, Belgium, Canada, Denmark, Finland, France, Germany, Ireland, Italy, Japan, Netherlands, Norway, Russia, Spain, Sweden, Switzerland,...
... in these areas We also chose to place The activity and stability ofthe Vibrio AP was measured for each mutation, before and after spinlabeling Furthermore, the activity and stability ofthe ... activity in the standard assay and EPR spectra ofthe spin-labeled WT AP were measured after incubation in urea The scaled mobility factor (Ms) was calculated from the central linewidth ofthe EPR ... spin-label and backbone uctuations Analysing the lineshape ofthe resulting EPR spectrum of R1 can reveal detailed information about the protein, such as secondary and tertiary structural interactions,...
... cyanabacteria andthe spread of aquatic weeds such as water hyacinth (Eichornia Crassipes) Water hyacinth infestation has chocked water ways and landings thereby hindering commercial transportation, ... the water surface The major algae blooming zone on the Kenyan side ofthe lake is in the Nyanza Gulf that encompasses Kisumu municipality and is mainly dominated by the blue and green algae The ... increase in giardia and cryptosporidium parasites and gramnegative bacteria commonly found in sewage Tab.2 Feacal Coliform Count in Migosi and Manyatta Sewage spills into the lake causes increased...
... simulation and later The theoretical pentameric and hexameric conformations ofthe a- syn multimers on the membrane are reminiscent ofthe pore-like appearance of cell-free a- syn aggregates that have ... modeling and molecular dynamics simulations, in combination with biochemical and ultrastructural analysis, that 1870 a- syn can arrange into homodimers that can adopt nonpropagating and propagating ... (Fig 2A and 3A) Fig Molecular modeling of nonpropagating and propagating a- syn aggregates on the membrane (A) a- syn minimal energy nonpropagating dimers (head-to-tail) (B) a- syn conformer at 4.0...
... flows are only constrained by topographical features, and questioned the actual enforcement of such standards Honaganahali added that the US National Ambient Air Quality Standards (NAAQS) are healthbased ... healthbased standards for criterial pollutants that apply for an airshed as a whole These standards have the health risks factored in them, which basically means that if an airshed is compliant ... burning, and mortality in Chiangmai Puttanna S Honaganahali (Institute for Social and Economic Change, India) stated that, in India, agricultural burns are seasonal events that last from a fortnight...
... Equation for a random Gaussian force that was band-limited to 200 Hz and had a standard deviation of σs = pN (b) Sensitivity as a function ofthe amplitude ofthe sinusoidal external force Values ... is the maximum permeability of IDRK ; [K]in = 112 mM and [K]ex = mM are intracellular and extracellular K+ concentration; F and R are Faraday and universal gas constants; T = 295.15 K is the ... did not lead to significant quantitative changes in thedynamicsofthe system The bifurcation analysis ofthe deterministic model was conducted using the software packages CONTENT and MATCONT [24,...
... Now, assume that parameters a1 , b1, A1 , g2, A2 , and B2 satisfy the condition (8) and inequality 1.i) of Lemma The proof of Theorem is similar to the proof of Theorem in the regions (ℛ9) and (ℛ10) ... assume that parameters a1 , A1 , g2, A2 , and B2 satisfy the condition (8) and inequality 1.i) of Lemma Then the set I= x, A1 A2 β1 + xA1 B2 β1 B2 α1 − A2 β1 :x≥0 is invariant and contains the equilibrium ... are the stable and unstable manifolds of x Theorem In addition to the hypotheses of part (B) of Theorem 6, suppose that μ >1 and that the eigenspace Eμ associated with μ is not a coordinate axis...
... existence and global attractivity of positive periodic solutions ofthe system (1.3) We note that the time delay has an effect on the permanence andthe global attractivity of periodic solution of system ... (No.2009IM010400-1-39) Authors’ contributions HL carried out the main part of this article, WW corrected the main theorems All authors read and approved the final manuscript Competing interests The authors declare ... and global stability for a predator-prey model with modified LeslieGower and Holling-type II schemes Appl Math Lett 2003, 16(7):1069-1075 Nindjina AF, Aziz-Alaoui MA, Cadivel M: Analysis of a...
... chemical control That is, p1 p2 They investigated the abundance of complex dynamicsofthe system 1.3 theoretically and numerically The main purpose of this paper is to investigate thedynamicsof ... ofthe prey andthe predator at time t, respectively Usually, K is called the carrying capacity ofthe prey The constant a is called intrinsic growth rate ofthe prey The constants e, d are the ... in a stable cycle while the prey x t rapidly decreases to zero On the other hand, if the amount q of releasing species is smaller than qmax , then the prey andthe predator can coexist on a stable...
... Gopuraja Dharmalingam, Mr Thilak Rajasekaran, Dr Kaushik Raghunathan, Mr Madhu Balasubramanian, Mr Santio Ruban and Mr Vasanthakumar Chandran My friends in the research team Dr Karthik Harve, ... vicissitudes ofthe graduate school came from my friends at NUS, particularly, Dr Karthiga Nagarajan, Mr Vivek Vasudevan, Dr Satyen Gautam, Mr Sundaramurthy Jayaraman and my friends elsewhere around the ... characterized the intrinsic dynamicsofthe protein andthedynamicsand thermodynamics of water in the hydration layer for EcoRI bound to a noncognate sequence (TAATTC) that differs from the...
... demand andthe order rate respectively This means that the outputs are mathematically determined by the inputs and any mathematical function can be used in theory Along with the demand andthe ... well as the environment: a car ahead which brakes, a turning, • Then, he analyses the data he has just observed and acts on the steering wheel andthe pedals to change the characteristics ofthe ... that the expected demand over the lead time is calculated from the latest available value ofthe expected demand It is assumed to be equal to the expected value ofthe demand times the number of...
... providedas is likelythat alternatives are available By the same token, the controversy about the practicality andthe adequate level ofa market share threshold for dening the scope of application of ... Complementary Strategies and Complementary Assets, 28 R and D Management 263; Arora A. , Fosfuri Aand Gambardella A (2003): Markets for Technology and Corporate Strategy, in Granstrand O., ed., supra ... and forner Director General ofthe Legal Service and Competition Directorate at the European Commission, Brussels Fels Allan, Dean oftheThe Australia and New Zealand School of Government (ANZSOG),...
... biofilm formation and cellulose degradation The reason why C obsidiansis cells did not grow into the cellulose at h and earlier might be attributable to the available peripheral substrate at the ... cellulolytic biofilms After the initial attachment phase when the bacteria form inverted colonies and depressions in the substrate, the biofilm maintains a thin and uniform profile (approximately 10 ... emphasize the critical role of biofilm formation in cellulose degradation Hence, a rapid startup of cellulose hydrolysis is theoretically achievable by increasing the number of bacteria attached on the...