block to increase the footprint of a link
báo cáo khoa học: "Feedback GAP: study protocol for a clusterrandomized trial of goal setting and action plans to increase the effectiveness of audit and feedback interventions in primary care" pdf
... explore the barriers and facilitators to Ontario family physicians’ acceptance and utilization of performance feedback, and to examine the perceived actionability of various approaches to the design ... human behavior Edited by: Ramachandran VS Toronto: Academic Press; 1994:71-81 Ajzen I, Manstead ASR: Changing health-related behaviors: An approach based on the theory of planned behavior In The ... amongst Canadian family practitioners, who manage the bulk of care for these patients [2] Unfortunately, there remains a large gap between ideal and actual care provided to such patients, making them...
- 10
- 597
- 0
báo cáo khoa học: " A quasi-experimental test of an intervention to increase the use of thiazide-based treatment regimens for people with hypertension" docx
... Review and present literature on effectiveness of "academic detailing" to change physician behavior Patient and Administrator Liaison Team Provide informational materials to patients and answer their ... algorithms on the electronic records in the data warehouse Using these data, our study statisticians conducted all statistical analyses Upon enrollment at the Houston VAMC, an administrator assigned ... of the study, the GMS ambulatory practice was a teaching service that included approximately 150 trainee physicians in postgraduate years one to three during any academic year, staff assistants,...
- 13
- 344
- 0
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar to ... and other parameters related to the customer, whereas the role of the employees, their satisfaction, loyalty and the link between these variables and profitability is not often included in marketing...
- 15
- 796
- 0
Ten Ways to Improve the Security of a New Computer doc
... daily, and vendors frequently make new signatures available, so antivirus software will be most effective if the signatures are up to date Many antivirus and antispyware programs offer automatic ... automatic updating Enable that feature so your software always has the most current signatures If automatic updates aren’t offered, be sure to install the software from a reputable source, like the vendor’s ... sure to research these features before disabling or modifying them The AutoRun feature in Microsoft Windows systems was a default feature at the time of the Conficker malware and was one of the...
- 5
- 620
- 0
Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx
... existing data management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that ... surface waters has already been observed in the Canada Basin of the Arctic Ocean (Bates et al., 2009; Yamamoto-Kawai et al., 2009) Persistent undersaturation of surface waters with respect to aragonite ... delineates ambitious priorities and goals for the National Ocean Acidification Program The FOARAM Act calls for the development of a detailed, 10-year strategic plan for the National Ocean Acidification...
- 163
- 400
- 0
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx
... Scientific Software Development GmBH, Berlin, Germany), a qualitative data management software [58], will be used to manage and analyze all qualitative data Quantitative analysis All tests will ... dominant language (e.g., Spanish) to reduce language barriers and drafting all patient educational materials at the appropriate reading level (e.g., fourth grade) to enhance health literacy Surface ... transcripts and develop an open coding schema based on a priori and emergent themes Each code condenses the data into analyzable units, ranging from a phrase to paragraphs They will then meet with the...
- 12
- 423
- 0
A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing ppsx
... with footwear being a major cause of traumatic ulcers [8] Lack of awareness of risk factors associated with diabetic foot ulcer by health care professionals and patients adds to unnecessary morbidity ... and Management of Diabetes in Canada [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management ... educational sessions for staff related to the clinical application of practice recommendations Senior administrators estimated that approximately 70 percent of staff typically attend 'usual' strategies...
- 10
- 521
- 0
báo cáo khoa học: " A mixed methods pilot study with a cluster randomized control trial to evaluate the impact of a leadership intervention on guideline implementation in home care nursing" docx
... with footwear being a major cause of traumatic ulcers [8] Lack of awareness of risk factors associated with diabetic foot ulcer by health care professionals and patients adds to unnecessary morbidity ... and Management of Diabetes in Canada [http://www.diabetes.ca/cpg2003/chapters.aspx?agrowing healthcareproblem.htm] Canadian Diabetes Association (CDA): Clinical practice guidelines for the management ... educational sessions for staff related to the clinical application of practice recommendations Senior administrators estimated that approximately 70 percent of staff typically attend 'usual' strategies...
- 10
- 453
- 0
Báo cáo khoa học: "Is it time to increase the frequency of use of high-frequency oscillatory ventilation" pps
... Although the utility of HFOV as rescue therapy is clearer, its precise role as primary therapy in patients with ARDS remains unclear The trial by Bollen and colleagues serves to demonstrate the challenges ... results of comparative trials of ventilation strategies and modes back to conventional mechanical ventilation are even more indistinct, with no clear direction with respect to the priority of airway ... in ARDS a realistic estimate of the recruitment rate into such trials is somewhere in the range of one patient every other month [1,6] 340 Ultimately, many of the questions regarding the use of...
- 2
- 222
- 0
LET''''S LEARN ENGLISH WITH A SMILE - HOW TO TELL THE SEX OF A BIRD - PHÂN BIỆT CHIM TRỐNG CHIM MÁI - MẶT TRỜI BÉ CON - TRẦN TIẾN
... HOW TO TELL THE SEX OF A BIRD THIS IS AMAZING !!! Until now I never fully understood how to tell the difference between Male and Female birds I always thought it had to be determined surgically ... now Below are two birds Study them closely See if you can spot which of the two is the Female It can be done Even by one with limited bird watching skills…! Send this to all of the men you ... watching skills…! Send this to all of the men you know, who could with a good laugh, and to all women who have a great sense of humor !!! Collection by FGMLGMU 06/03/2011 ...
- 4
- 465
- 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
... formic acid and stored at )20 °C until MS analysis High mass MALDI-TOF MS High-mass MALDI-TOF mass spectra of the intact protein complexes were obtained using a MALDI-TOF mass spectrometer (Voyager ... critical for assembly An alternative explanation that can account for this observation is that Ssa1p binds with higher affinity a conformational state of Ure2p as a result of the presence of the ... 993 Da), and another where two Ure2p molecules are bound to one Ssa1p (151 346 Da) Because the binding of the cross-linkers leads to an increase in the molecular mass (Table S1), the number of...
- 12
- 510
- 0
Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx
... 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgatgctctaccgactgagctatccgggc 3' (tRNALys,3); 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and ... tgccccgtgtgaggatcgaactcacg accttcagattatgagactgacgcgctacctactgcgctaacgagg (tRNAMet(e)); 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg 3' and 5' tagcagaggatggtttcgatccatcg acctctgggttatgggcccagcacgcttccgctgcgccactctgct ... (Stratagene) was used with the following sets of primers: 5' ggaaaatctctagcagtggtagcagaggatggttctgaaagcgaaagggaaac 3' Met(i) 5' gtttccctttcgctttcagaaccatcctctgctaccactgctagagattttcc 3' 5' ggaaaatctctagcagtggtagcagagggtggttctgaaagcgaaagggaaac...
- 14
- 189
- 0
AN1050 a technique to increase the frequency resolution of PICmicro® MCU PWM modules
... is toggled each time the period of the output signal is changed as a timing reference The graph in Figure has been recorded using the MPLAB SIM simulator and taking a snapshot of the Logic Analyzer ... FRAC to the accumulator ; get the base period value in W ; if there was a carry in the fractional accumulator ; signal longer period (T1) ; signal shorter period (T2) FACC,4 ; clear the carry bit ... generate a variable frequency digital signal with good frequency resolution using a combination of on-chip hardware and software The provided code example generates a 100 kHz signal that can be adjusted...
- 10
- 194
- 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together...
- 88
- 986
- 8
Vcd as a stimulating factor to increase the young learners’ time-on-task
... repeat and participate in a single activity The advantages of using VCDs in English class are also clearly understood as shown in the table and chart above One of the most appreciated materials applied ... based on the assumptions that the main determinants of motivation are the learners' attitudes to the target language community and their need to learn the L2 Motivation can affect the extent to ... that they want to be identified as a member of the family Hence, the children tend to take on many behavioral characteristics of the parents and their behaviors are modified by that of the parents...
- 45
- 516
- 0
A computational study to investigate the effects of insulation and EGR in a diesel engine
... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering,...
- 20
- 643
- 0
Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english a comparison
... situations It was found that the frequency of the use of the speech act of refusal by the Australian NSs of English was different from that by the VLEs Although the VLEs and the Australian NSs of ... Beebe et al (1987), more advanced learners are more affected by the refusal strategies of their native language, whereas the native language of the learners in Yagamashira’s study had more influence ... shift their refusal strategies noticeably according to the status of the interlocutors The above review of the related literature of the speech act of refusal shows that the use of refusal strategies...
- 44
- 1,183
- 4
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... can be measured via these same factors, even if the individual case is a strategy for which new tools are used The analysis revealed that one of the essential organizational factors, because of ... with their work The results are valued on a Likert scale of to for the different items Over the last few years, the average satisfaction index—calculated as the average of the values given to each ... leadership, and the adoption of a radical change model First, Irizar’s strategy was oriented towards To know, serve and add value for the customer’ For adaptation to the customer’s requirements, the...
- 10
- 1,063
- 1
Tài liệu Exporting the Results of a Query to an Array pdf
... from the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the ... Object[][] tableArray = GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and ... = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection of rows in the...
- 5
- 309
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25