p c v and m proteins in mini genome replication assays
Tài liệu Báo cáo khoa học: DNA modification with cisplatin affects sequence-specific DNA binding of p53 and p73 proteins in a target site-dependent manner pptx
... 1) were supplied by VBC Genomics (Vienna, Austria) Plasmids pPGM1 and pPGM4 [derivatives of pBSK(+) vector containing the PGM1 and PGM4 sites; Fig 1] were prepared as previously described [17,33] ... 34 Pivonkova H, Brazdova M, Kasparkova J, Brabec V & Fojta M (2006) Recognition of cisplatin-damaged DNA by p5 3 protein: critical role of the p5 3 C- terminal domain Biochem Biophys Res Commun ... Bartek J, Midgley CA & Lane DP (1992) An immunochemical analysis of the human nuclear phosphoprotein p5 3 New monoclonal antibodies and epitope mapping using recombinant p5 3 J Immunol Methods 151,...
- 14
- 597
- 0
Báo cáo khoa học: Dynamin-related proteins and Pex11 proteins in peroxisome division and proliferation doc
... induce mitochondrial fragmentation and programmed cell death (PCD) [136] The overexpression of DRP-1 can induce PCD, indicating an evolutionary conservation of mitochondrial involvement in PCD ... trafficking to the vacuole (vacuolar protein sorting) [105–107] Vps1 also participates in clathrin-dependent trafficking from the Golgi via a prevacuolar compartment to the plasma membrane This pathway ... of DRPs are Mx proteins, mammalian DLP1, and the yeast proteins Dnm1, Mgm1 and Vps1 Mx proteins are interferon-inducible DRPs [98] Like dynamin, they self-assemble and bind and tubulate lipids,...
- 13
- 372
- 0
Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf
... expression Table Summary of liver proteins that are differentially expressed (P < 0.01) in mitochondrial ⁄ lysosomal (ML), peroxisomal (P) and cytosolic (C) fractions C C C C C C C C ML P P C ML ... expressed (P < 0.01) in mitochondrial ⁄ lysozome (ML), peroxisomal (P) and cytosolic (C) fractions – – – – – – – – 0.191 – – – – – – – – – 0.25 0.225 Vol (%) C C C C C C C C C C P P P C C ML ML ... NADP(+)-dependent, cytosolic DnaJ (Hsp40) homolog, subfamily A, member Apolipoprotein A-IV Actin, b, cytoplasmic NSFL1 (p9 7) cofactor (p4 7) Aminoacylase Phosphoglycerate mutase Indolethylamine N-methyltransferase...
- 9
- 481
- 0
Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx
... (reverse) For p1 5 the primers used were CAGAGCTGTTGCTCCTCCAC (forward) and CGTGCAGATACCTCGCAATA (reverse) For p2 1 the primers used were AGCAAAGTATGCCGTCGTCT (forward) and ACACGCTCCCAGACGTAGTT (reverse) ... PCR L of cDNA template was amplified in a 25-L reaction volume of GeneAmp PCR buffer (Applied Biosystems), containing 5.5 mM MgCl2, 200 M of each dNTP, 0.5 M of appropriate primer pairs and ... Cip/Kip family (p2 1, p2 7, and p5 7) show broader substrate specificity inactivating both cyclin D-CDK4/6 and cyclin ECDK2 kinase complexes [28] We examined the expression of p1 5INK4, p2 1WAF1/Cip1...
- 12
- 535
- 0
Báo cáo y học: " Determination of the relative amounts of Gag and Pol proteins in foamy virus particles" doc
... Gag and Pol molecules per particle Prokaryotic expression and purification of viral proteins The cloning strategy [9,10] and the purified recombinant proteins are depicted in Fig pETgag2 was made ... Lindemann D, Rethwilm A: Improved primate foamy virus vectors and packaging constructs J Virol 2002, 76:3774-3783 Moebes A, Enssle J, Bieniasz PD, Heinkelein M, Lindemann D, Bock M, McClure MO, ... determination of the relative amounts of Gag and Pol proteins in purified PFV Representative example of the determination of the relative amounts of Gag and Pol proteins in purified PFV (A) Extracellular...
- 7
- 318
- 0
Role of bcl 2 in metabolic and redox regulation via its effects on cytochrome c oxidase and mitochondrial functions in tumor cells
... implicates a major chemotherapeutic advantage considering that tumor cells often overexpress antiapoptotic Bcl-2 and introducing pro-apoptotic Bcl-2 family mimetics can specifically target and ... discovered and documented These Bcl-2 family proteins were generally classified into two major groups, namely pro-apoptotic and anti-apoptotic Some of the proapoptotic proteins include Bax and ... survival-promoting pro-oxidant state by Bcl-2 in tumor cells, from the perspective of an involvement in mitochondrial functions and COX activity Interestingly, during our study, a novel, unexpected...
- 78
- 267
- 0
Báo cáo khoa học: Proteomic identification of all plastid-specific ribosomal proteins in higher plant chloroplast 30S ribosomal subunit PSRP-2 (U1A-type domains), PSRP-3a/b (ycf65 homologue) and PSRP-4 (Thx homologue) doc
... primer or lM degenerate primer, lM lambda arm primer (PF or PR), 200 lM each dNTP, 1.5 mM MgCl2, and 50 mM KCl in 20 mM Tris/HCl (pH 8.4) PF (forward primer) and PR (reverse primer) are complementary ... and primer sets P2 -1 and PR Gene-speci c PCR primers for Psrp-2, Psrp-3 and Psrp-4 (P2 -2, P3 -2 and P4 2) were designed from the nucleotide sequence of PCR products, P2 -1/PR, P3 -1/PR and P4 -1/PR ... higher plant chloro-ribosome (Table 1) In terms of protein character PSRPs can be divided into two groups: (a) acidic proteins, PSRP-1, PSRP-2 and PSRP-3; (b) small/basic proteins, PSRP-4, PSRP-5 and...
- 16
- 528
- 0
conte r., magri f., musette m., satsuma j, and winternitz p. direct and inverse methods in nonlinear evolution equations, greco a. m.
... each volume As a rule, no reprints of individual contributions can be supplied Manuscript Submission The manuscript in its final and approved version must be submitted in ready to print form The corresponding ... or Springer-Verlag LNP Online archive: springerlink.com Vol.588: Y Watanabe, S Heun, G Salviati, N Yamamoto (Eds.), Nanoscale Spectroscopy and Its Applications to Semiconductor Research Vol.589: ... Turbulence and Magnetic Fields in Astrophysics Vol.615: J B¨ chner, C. T Dum, M Scholer (Eds.), Space u Plasma Simulation Vol.616: J Trampetic, J Wess (Eds.), Particle Physics in the New Millenium Vol.617:...
- 287
- 805
- 0
Báo cáo sinh học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" potx
... growthHPIV1 wt and rHPIV1 mutant viruses containing the indicated mutations in the P/ C, HN and Comparison Comparison of the replication of HPIV1 wt and rHPIV1 mutant viruses containing the indicated ... parainfluenza virus type vaccine candidate by replacing the HN and F glycoproteins of the live-attenuated PIV3 cp45 vaccine virus with their PIV1 counterparts Vaccine 1999, 18:503-510 Clements ML, Belshe ... Murphy BR, Prince GA, Collins PL, Van Wyke Coelingh K, Olmsted RA, Spriggs MK, Parrott RH, Kim HW, Brandt CD, Chanock RM: Current approaches to the development of vaccines effective against parainfluenza...
- 13
- 504
- 0
Báo cáo hóa học: " Attenuation and efficacy of human parainfluenza virus type 1 (HPIV1) vaccine candidates containing stabilized mutations in the P/C and L genes" docx
... growthHPIV1 wt and rHPIV1 mutant viruses containing the indicated mutations in the P/ C, HN and Comparison Comparison of the replication of HPIV1 wt and rHPIV1 mutant viruses containing the indicated ... parainfluenza virus type vaccine candidate by replacing the HN and F glycoproteins of the live-attenuated PIV3 cp45 vaccine virus with their PIV1 counterparts Vaccine 1999, 18:503-510 Clements ML, Belshe ... Murphy BR, Prince GA, Collins PL, Van Wyke Coelingh K, Olmsted RA, Spriggs MK, Parrott RH, Kim HW, Brandt CD, Chanock RM: Current approaches to the development of vaccines effective against parainfluenza...
- 13
- 520
- 0
Báo cáo y học: "Hepatitis C virus core, NS3, NS4B and NS5A are the major immunogenic proteins in humoral immunity in chronic HCV infection" potx
... Expression of recombinant HCV proteins Expression of recombinant HCV proteins A Individual HCV genes were cloned into pcDNA3.1(+) plasmid under CMV promoter The expression of HCV proteins was verified ... recombinant HCV proteins in insect cells To produce recombinant HCV proteins individual HCV genes from genotype 1b cDNA were amplified with PCR and the products were subcloned into the pcDNA3.1(+)FLAG ... recombinant HCV proteins Detection of anti-HCV antibodies in HCV RNA and antibody positive human sera with recombinant HCV proteins μg of each baculovirus-expressed and preparative SDS-PAGE-purified...
- 12
- 310
- 0
Eating out en francais more than 2,000 food and wine terms in english and french plus mini phrasebook and guide to wine regions (english and french edition) a c
... cannelloni aux champignons mushroom cannelloni cantaloup cantaloup (melon) cappuccino cappuccino coffee c pres capers carafe carafe carafe deau carafe of water, jug of water caramel caramel caramel ... stock Mm macaron macaroon macaroni macaroni macộdoine de fruits fruit salad; fruit cocktail macộdoine de lộgumes mixed vegetables m che lambs lettuce macis mace macrobiotique macrobiotic madeleine ... chilli chinchard horse mackerel chips (potato) crisps; [US] chips chocolat chocolate, cocoa chocolat au lait milk chocolate chocolat blanc white chocolate chocolat glacộ chocolate-covered ice lolly...
- 145
- 682
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25