... 5'- GACTCATGACTGTTGTTACAACC-3' and reverse 5'-TCTCAGGACTCTCTTAGGTACTA-3' that amplify a 493 bp fragment, and primers for β-actin are: forward 5'-TGGAGAAGAGCTATGAGCTGCCTG-3' and reverse 5'-GTGCCACCAGACAGCACTGTGTTG-3' ... microglia Neurobiol Aging 2001, 22(6):957-966 Lue LF, Walker DG, Rogers J: Modeling microglial activation in Alzheimer's disease with human postmortem microglial cultures Neurobiol Aging 2001, 22(6):945-956 ... involved in initiating astrocyte activation and inflammatory cascade [49], its ability to induce sPLA2-IIA mRNA in astrocytes suggests that sPLA2-IIA upregulation could be engaged in early inflammatory...
... to amplify spondin-2 were: sense, 5'CTCGTTTGTGGTGCGCATCGTG-3'; antisense, 5'-CAGGGAGACCTCGCAGTCCAGC-3' The thermal cycling parameters were; cycle of 94°C for 2.5 minutes followed by 40 cycles of ... control amplifications: 5'-GTTGCGATCGTGCTGTGCGTCT-3'; 5'CGACGCTAGCTCAGCACGCGAG-3' The thermal cycling parameters were; cycle of 94°C for 2.5 minutes followed by 20 cycles of 94°C for 40 seconds, 60°C ... imaging of PCR products and hematoxylin-stained tissue details The silver particles were bound to PCR products via anti-digoxygenin antibodies, and proved resistant to diffusion, remaining in...
... TGG GTG AG ATC CTC CCT GAA TCT GAC AGG TGG GTG GCA GAA AAG CTG TT GTG TCA ATC AGT GCC ATT GAC C TCC CGT ATT TTC TTG CGC TC GAT GCC ATT TTT CCT TCT CC AAC ATG GAT GGT GTA ACT GG TCT CTA TAG TGT ... lineage số Dòng độc lực cao Trung Quốc thuộc lineage số Một vài mẫu từ Ý thuộc lineage số số Các chủng vacccine sử dụng đƣợc phân tích Vaccine MLV (Boehringer Ingelheim, Germany) chủng g c VR ... thuộc sublineage só 5.1 tƣơng tự nhƣ phần lớn mẫu trình tự giới Vacccine dòng ATP (Boehringer Ingelheim, Germany) thuộc sublineage 8.9 Vaccine dòng PrimePac Neb-1 thuộc lineage số Chủng có độc...
... DiagMR GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA ... and hemagglutination inhibition tests in the diagnosis of influenza A and B virus infections”, Purified hemagglutinin in subtype-specific diagnosis, J Vir.Methods 10, 75-84 34 Kandun IN, Wibisono ... characterization of the H5 gene for the highly pathogenic A/H5N1 strains isolated in Vietnam during 2004 – 2006”, Proceedings of International Workshop on Biotechnology in Agriculture, p 68-71 31...
... by Lipman et al., (1994), and were kindly provided by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' ... status, ■ represents HIV negative status, and ▲ ! reepresents unknown status Page of (page number not for citation purposes) Journal of Negative Results in BioMedicine 2003, whole blood using ... References Piatak M Jr, Saag MS, Yang LC, dark SJ, Kappes JC, Luk KC, Hahn BH, Shaw GM and Lifson JD High levels of HIV-1 in plasma during all stages of infection determined by competitive PCR Science...
... 590C Giếng 7: Phản ứng 600C Giếng 2: Phản ứng 550C Giếng 8: Phản ứng 610C Giếng 3: Phản ứng 560C Giếng 9: chứng âm Giếng 4: Phản ứng 570C Giếng 5: Phản ứng 580C Tín hiệu giếng 590C cho tín hiệu ... 496bp GAVr 5’-CCGTCTGTTGTTCGAGAAATTCAACAATC-3’ 58,3 TSVf 5’- TCAGCTTCGACAGTCTCTCCTAATATTG-3’ 57,6 TSVr 5’-TCAATTATCCAGCAGATGTTCCTGAGG-3’ 58,4 130bp 28 2.1.4 Hóa chất tách chiết RNA Chúng sử dụng ... phần miệng; mang biến sang vàng-hồng, quan sát thấy giun hình ống hà bám mang bẩn Những biểu chung nhiễm GAV cấp tính thay đổi nhận thấy được, chúng không đáng 18 tin cậy chẩn đoán sơ Bệnh g y chết...
... P3 (5'-AATGAATGGATGCCTGGGGTTT-3') were used as the primer specific for CDV species, wildtype strains, and vaccine strain Onderstepoort, respectively Primer P4 (5'-ACGTCCTGGACCCTAAGTTTTG-3') was ... samples from Heilongjiang province were selected for amplification of the H gene of CDV by RTPCR with primers P5 (5'-CCAATTCATCCAAGCTGTCC-3') and P6 (5'-GGGATTTGAACGGTTACATGAG-3') The amplified ... different farms in Heilongjiang and Jilin provinces of China RT-nPCR was used to detect the cells infected with CDV vaccine strain, wild-type strain, mixed CDV vaccine and wild-type strains, CPV, CAV,...
... 5’-TGTCGGCATCATGATTGG-3’ (sense) and 5’-GCAAATGCTTTAAGGAAGAAGC-3’ (antisense) Fluorescent and LC-Red probe sequences used for CEA identification were: 5’-CCTGAAATGAAGAAACTACACCAGGGC-fluorescein ... establishing metastatic disease [25] These circulating cancer cells might not attach to distant organs and might not grow Recently, Méhes et al [38] investigated the morphology of circulating cancer cells ... were: 5’-TGAACGGGAAGCTCACTGG- Page of 3’(sense) and 5’-TCCACCACCCTGTTGCTGTA-3’ (antisense) The probe sequences used for GAPDH identification were: 5’-TCAACAGCGACACCCACTCCTfluorescein and 5’-LC-Red...
... Primers/probes used in the study Primer/probe Primer/probe sequence (5' 3') Position As 5'-GAGTAGTGTTGGGTCGCGAA-3' 256 275 Aa 5'-GTGCACGGTCTACGAGACCTC-3' 320 340 Ap FAM5'-CCTGATAGGGTGCTTGCGAGTGCC-3' BHQ ... FAM5'-CCTGATAGGGTGCTTGCGAGTGCC-3' BHQ 292 315 Bs 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 161 182 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 121 144 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' BHQ BHQ: Black ... probe Bp-binding site sequences, which were replaced by the internal probe sequences (Figure 3) Gene splicing by overlap extension PCR was performed to construct an IC sequence containing fragments...
... vaccine strains (Fig 1) The primers used for vaccine strain amplification were F-vacc: 5'CATCAGCCATGATCAGGGTCTTTTC-3' and R-vacc: 5'-GGGCGGTCTTGTTGGGTATGTGTTT-3' The primers used for field strain ... polymerase chain reaction (PCR) with the outer primers CDF-F: 5'-AGAGTGCAAAATAGTAAGAATCCAAGC-3' and CDF-R: 5'-GAAAGAGACTGGCTATTCCGATGC-3', which amplified a fragment containing the M gene (115 downstream ... of Fsp region in various CDV strains in GenBank database indicates that TGC motif used to specifically target local isolates is highly conserved among the Asia-1 lineage These findings demonstrated...
... 2007 Year New Cases IgM + IgG + IgM -, IgG - Figure Percentage of dengue cases 2003–2007 Percentage of dengue cases 2003–2007 Discussion The lack of a vaccine or a cure for dengue fever makes the ... patients with dengue who were initially investigated for leptospirosis, indicated that serotypes during that period (1995–1997) where 1, or [9] The current study investigating patients during the five ... having dengue IgM antibodies There is an average positivity of 38.5% in patients suspected of having dengue fever over the past five years However, this figure dipped in 2005, where an average...
... 5’-3’ Vị trí DiagH5F AGTGATCAGATTTGCATTGGTTAC DiagH5R Tm %GC 46-69 54.6 37.5 55.4 47.6 GACCAAGAACTTTTGGGGATG 416-396 Mồi xuôi (DiagH5F) mồi ngược (DiagH5R) đươ ̣c lựa cho ̣n để phát gen HA của ... kháng thể đặc hiệu với HA, giếng có hồng cầu không bị ngưng kết mà lắng xuống đáy giếng Hiệu giá HI tỉ lệ pha loãng huyết thấp ức chế ngưng kết hồng cầu [33] 19 Phản ứng HI thường sử dụng để ... Minh, Viện Vệ sinh dịch tễ trung ương, Viện Thú y giải mã công bố Ngân hàng gen [30, 38] Trên sở phân tích trình tự gen kháng nguyên H5 N1, tác giả khẳng định nguồn g c virus cúm A g y bệnh gia...
... sources together with DNA ligase Restriction endonucleases generate ends that facilitate mixing and matching GAATTC CTTAAG GAATTC CTTAAG EcoRI cut G AATTC CTTAA GG AATTC CTTAA G Mix and ligate G AATTC ... G Recombinant molecules G AATTC CTTAA G GAATTC CTTAAG GAATTC CTTAAG Parental molecules DNA ligase covalently joins two DNA molecules • Uses ATP or NADH to provide energy to seal nicks DNA ligase ... remain after annealing two fragments together nick P OH P P P P P P P P A GG A A T T C T C C T T A A P G P P P P P P G T A C P A T P P P P P P OH P nick T4 DNA ligase + ATP P P P P P P P P P A G...
... CTTCACCCGGTTGCCAGAGG E coli Ec2: GGTGATTACCGACGAAAACGG SA1: GCGATTGATGGTGATACGGTT aureus Staphylococcus SA2: AGCCAAGCCTTGACGAACTAAAGC Bacillus cereus BC1: ATTGGTGACACCGATCAAACA BC2: GAATAACATCCATACGTATGA ... GAATAACATCCATACGTATGA Pl3: AAGTTACCTTTGCTGCATAATCCC perfringens Clostridium Pl7: ATAGATACTCCATATCATCCTGCT Salmonella invA1: TTGTTACGGCTATTTTGACCA invA2: CTGACTGCTACCTTGCTGATG * Quy trình phân tích mẫu phương ... Nguyễn Thị Bạch Huệ, cơng tác Phòng Thí Nghiệm Cơng Nghệ Sinh học Phân tử, Trung tâm Khoa học Cơng nghệ Sinh họcTrường ĐHKHTN, ĐHQG TP HCM, hết lòng giúp đỡ tơi suốt thời gian thực nghiệm Xin...
... GAATTCATGAAGCTACTGTCTTCT – 3’ 5’ TGAAAGATGAAGCTACTGTCTTCT ’ ACTTTCTACTTCGATGACAGAAGA GGATTATTTGTACAAGATAATGTG ’ Gen GAL4 CCTAATAAACATGTTCTATTACAC 5’ 3’ – CCTAATAAACATGTTCTACCTAGG – 5’ Mồi PCR ... EcoRI BamHI 5’ – GAATTCATGAAGCTACTGTCTTCT 3’ – CTTAAGTACTTCGATGACAGAAGA Gen GAL4 GGATTATTTGTACAAGATAATGTG ’ CCTAATAAACATGTTCTATTACAC ’ Các mồi dùng để nhân phần gen GAL4 từ hệ gen Saccharomyces ... GCACTAGGATCGATCGATGC – 5’ PCR 5’ – GATCGATCGATACGTGATCCTAGCTAGCTACG – 3’ 3’ – CTAGCTAGCTATGCACTAGGATCGATCGATGC – 5’ * Ghép đôi sai mồi Các mồi oligonucleotit dùng cho kỹ thuật PCR phải ghép đôi xác với trình...