mechanism of urinary bladder carcinogenesis induced by a xanthine oxidoreductase inhibitor in r
Báo cáo Y học: Mechanism of 1,4-dehydrogenation catalyzed by a fatty acid (1,4)-desaturase of Calendula officinalis pptx
... the pYJ/DTY1 0a2 strain of S cerevisiae incubated at 20 °C for days to permit relatively rapid growth and then at 15 °C for a further days to reach saturation at a temperature which has been found ... Whether these two transformations are catalyzed by separate enzymes in this case remains to be determined In summary, the cryptic site of initial oxidation for an important plant fatty acid conjugase-mediated ... the intrinsically high energy content of radical intermediates relative to product Some decades ago, Morris and Marshall [36] speculated that conjugated trienoic fatty acids are produced in plants...
- 6
- 341
- 0
Báo cáo khoa học: Targeting mechanism of the retinoblastoma tumor suppressor by a prototypical viral oncoprotein Structural modularity, intrinsic disorder and phosphorylation of human papillomavirus E7 doc
... suggesting that E7 may bind at this interaction site and displace Rb protein cellular targets The viral transforming proteins AdE 1A and SV40LT, in addition to nine cellular protein targets of Rb ... Burghammer M, Perrakis A, Marmorstein R & Gamblin SJ (2003) Crystal structure of the retinoblastoma tumor suppressor protein bound to E2F and the molecular basis of its regulation Proc Natl Acad ... Groisman R, Naguibneva I, Robin P, Lorain S, Le Villain JP, Troalen F, Trouche D & Harel-Bellan A (1998) Retinoblastoma protein represses transcription by recruiting a histone deacetylase Nature...
- 16
- 404
- 0
báo cáo khoa học: " Identification of differentially expressed genes induced by Bamboo mosaic virus infection in Nicotiana benthamiana by cDNA-amplified fragment length polymorphism" pps
... forward primers are (5’GAACAAAAAAATGGAGTTTTA3’), (5’CGAACTCCCAACTGGCTTTC3’), (5’CTCTGGAAAGGAGAGCAATGTC3’), and (5’GAAC GCTTTGATGAGAATAGAGA3’) and the reverse primers (5’GTCATTGCTCCTAATAAGGT3’), (5’CTCC ... 55°C for 30 sec, and 72°C for 30 sec PCR products were separated on a 5% polyacrylamide gel and visualized by EtBr staining Primer pairs for ACAG1 (forward, 5’GAGAAAATGAAGGAGAAGGCCC3’; reverse, ... benthamiana plants We have predicted that ACAG2 is a nuclear-encoded polymerase (NEP) interacting-protein (NIP) containing three transmembrane domains and one RING-H2 domain The RING domain is reported...
- 12
- 320
- 0
Báo cáo khoa học: "Plasma Calcium, Inorganic Phosphate and Magnesium During Hypocalcaemia Induced by a Standardized EDTA Infusion in Cows" docx
... Mellau LSB, Jørgensen RJ, Enemark JMD: Standardization and Interpretation of Experimental (Na2EDTA -induced) Hypocalcaemia in Cows In: Production Diseases in Farm Animals 10th International Conference, ... recovery from hypocalcaemia was calculated by subtraction This was defined as calcium regaining time (CRT) Analytical procedures Plasma total calcium and magnesium were determined by atomic absorption ... period and found the drop in plasma total calcium approached a linear curve Finally, Berger & Gerber (1977), Desmecht et al (1995) and van de Braak et al (1997) all reported a triphasic pattern of...
- 10
- 250
- 0
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc
... pro-caspase and caspase (C) Cells were treated with EGF and ADR as described in (A) Lysates were prepared at the indicated times after the ADR addition and analyzed for caspase activity by using a fluorometric ... stimulated through the MAP kinase cascade [49] Our study showed that EGF caused a substantial increase in AP1 DNA binding In addition, this increase was prevented by MAP kinase kinase inhibitor PD98059 ... R, Malik Z & Karasik A (1994) Epidermal growth factor, phorbol esters, and aurintricarboxylic acid are survival factors for MDA-231 cells exposed to adriamycin In Vitro Cell Dev Biol Anim 3 0A, ...
- 13
- 493
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... Hagiwara, Y., Hagiwara, H., Ueyama, H & Goldstein, A. L (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulates release of prolactin and growth hormone from rat anterior ... signal-regulated kinase and c-Jun NH2-terminal kinase but not p38 mitogen-activated protein kinases is required for RRR -a- tocopheryl succinate -induced apoptosis of human breast cancer cells Cancer Res 61, ... Biophys Res Commun 268, 329–332 29 Saura, M., Zaragoza, C., Bao, C., McMillan, A & Lowenstein, C.J (1999) Interaction of interferon regulatory factor-1 and nuclear factor jB during activation of inducible...
- 6
- 494
- 0
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx
... ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC ... mutations as indicated (rectangles) Bars indicate SD RNA cleavage assays were performed using proteins at 20 lL and the cleavable RNA substrate, 5¢-AUACA-3¢, at 50 lM in (B) and (E), whereas in ... technical ´ assistance of Alicia Rodriguez-Bernabe and discussions with Marc Lemonnier, Ana Marı´ a Hernandez´ Arriaga and Juan Lopez-Villarejo, are kindly acknowledged RB, AJRH, and MBK acknowledge...
- 14
- 477
- 0
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx
... activation was reported as a major mechanism for the IGF2 overexpression in a variety of tumors including bladder carcinoma, hepatocellular carcinoma, breast cancer, ovarian cancer and prostate cancer ... using the RNA STAT-60TM Total RNA/mRNA isolation reagent, according to the manufacture’s instructions The RNA was treated by RNAse-free DNAse I to eliminate any contaminating DNA Total cDNA was ... area of the malignant tissue of each bladder was determined by ImagePro Plus software Another healthy mice were used as control The total tumor area of each bladder was determined and the mean...
- 18
- 746
- 0
báo cáo hóa học:" A Rat Model of Early Stage Osteonecrosis Induced by Glucocorticoids" potx
... I, Floratou K, Alexandridis T, Kardamakis D: Abdominal radiation initiates apoptotic mechanism in rat femur bone marrow cells in vivo that is reversed by IGF-1 administration J Radiat Res (Tokyo) ... Fisher, Lewis, Spontaneous Hypertensive, Wistar Kyoto, and Wistar Furth rats (6 of each strain) were obtained from Charles River Laboratories (Pointe-Claire, QC, Canada) The rats were tagged and ... degeneration, necrosis, and disappearance of marrow cells as well as the nuclear disappearance and hypochromasia of trabecular osteocytes as early signs of ON [15] Early signs of ON was also considered...
- 23
- 331
- 0
Báo cáo khoa học: "A case of virilization induced by a Krukenberg tumor from gastric cancer" docx
... hypermenorrhea, followed by amenorrhea However, only abdominal swelling and abdominal pain are reported as symptoms of Krukenberg tumors, whereas abnormal vaginal bleeding and amenorrhea occur in only ... stomach The appendix, colon, small intestine, rectum, gallbladder and urinary bladder have also been reported as a site of the original carcinoma [9] Even intramucosal gastric cancer may lead ... Hotta S, Hirayama T, Yamada J, Ueda K, Sato M, Okumura M, Shimokama T, Oka Y: Early gastric cancer with Krukenberg tumor and review of cases of intramucosal gastric cancers with Krukenberg tumor...
- 5
- 305
- 0
Intra-articular injection of a nutritive mixture solution protects articular cartilage from osteoarthritic progression induced by anterior cruciate ligament transection in mature rabbits: a randomized controlled trial ppsx
... substrates for fibril forming collagen or PG in articular cartilage They include glycine, proline, hydroxyproline, glutamate, alanine, aspartate, serine, glutamine, arginine, lysine and methionine ... frequency of occurrence of about 10% or greater in the triple-helical structure of collagen were also selected These minor amino acids were glutamate, alanine, aspartate, serine, glutamine, arginine, ... Arthritis Research & Therapy Vol No Park et al Figure Scanning electron micrographs of articular cartilage surface of the medial tibial plateau These micrographs were taken at 19 weeks after anterior...
- 9
- 253
- 0
Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf
... leading to insulin resistance [26-29] Shi et al [9] reported that FFAs are themselves capable of triggering TLR4 signaling by trasducing production of proinflammatory markers in macrophages, adipocytes, ... DML, Anhe G, Amaral ME, Takshashi HK, Curi R, Oliveira HC, Caralheira JBC, Bordin S, Saad MJ, Velloso LA: Saturated fatty acids produce an inflammatory response predominately through the activation ... mutation in TLR4 protected against diet -induced obesity, hyperinsulinemia and inflammation in response to diet high in saturated fat [23] Several other investigators proposed that saturated fatty...
- 7
- 272
- 0
Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx
... leading to insulin resistance [26-29] Shi et al [9] reported that FFAs are themselves capable of triggering TLR4 signaling by trasducing production of proinflammatory markers in macrophages, adipocytes, ... DML, Anhe G, Amaral ME, Takshashi HK, Curi R, Oliveira HC, Caralheira JBC, Bordin S, Saad MJ, Velloso LA: Saturated fatty acids produce an inflammatory response predominately through the activation ... mutation in TLR4 protected against diet -induced obesity, hyperinsulinemia and inflammation in response to diet high in saturated fat [23] Several other investigators proposed that saturated fatty...
- 7
- 238
- 0
Báo cáo y học: "Ulceration of the oral mucosa induced by antidepressant medication: a case report" pps
... had basocellular carcinoma in her face and stomach cancer Extra-oral clinical examination showed facial symmetry and palpable, mobile, smooth and asymptomatic submandibular lymph nodes A shallow ... nonsteroidal antiinflammatory drugs and also after the use of mycophenolate or sirolimus, sodium lauryl sulfate, protease inhibitors, and sulfonamides In the era of transplantation, a frequent ... floor of the mouth, the lateral border of the tongue and the soft palate, although other areas of the mouth may also be involved Many cases of oral cancer are diagnosed during the advanced phase,...
- 4
- 296
- 0
Magnetic domain study of micron and nano sized permalloy structures induced by a local current
... industry 1.2 Using MRAM as an Example Ongoing research by various groups and industrial collaborations are currently in the process of understanding, fabricating and eventually commercializing ... central domain and vortices at the rounded ends was observed after removal of saturating field along long axis Magnetization reversal of central domain occurred at currents of 300 mA and 1000 mA ... introduced or expelled as a result of tip-sample interaction For nano-rods, a single domain structure was observed after initial saturation along long axis Magnetization reversal occurred at currents...
- 177
- 168
- 0
Báo cáo y học: "Effect of corticosteroids on phlebitis induced by intravenous infusion of antineoplastic agents in rabbits"
... proximal part of the vein in out of animals In addition, there was inflammatory cell infiltration (Grades 1-3) in the proximal part of the vein in all animals and in the distal part of the vein in of ... distal region in out of animals, inflammatory cell infiltration (Grades 1-2) at the proximal and distal regions in all animals, and edema (Grades 1-3) at the proximal and distal regions in all animals ... inflammatory cell infiltration (Grades 1-3) at the proximal region of the vein in animas and at the distal region in of the animals, edema (Grade 3) at the proximal region in animal and edema (Grade...
- 6
- 711
- 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... E, Freilino M & Grandis JR (2007) Antiproliferative mechanisms of a transcription factor decoy targeting signal transducer and activator of transcription (STAT) 3: the role of STAT1 Mol Pharmacol ... thereby impairing normal interaction with the nuclear transport machinery Alternatively, the hairpin ODN itself might interact with components of the nuclear transport machinery through its hairpin ... STAT1 A DAPI Merge STAT1 Contr-ODN ase (PARP) cleavage (Fig 3B) The transcriptional activity of STAT1, as measured with an interferon regulatory factor (IRF) 1-promoter luciferase reporter after...
- 11
- 558
- 0
Tài liệu Orthodontists and patient´s aesthetic perception to different types of profi les modifi ed by a computer program pdf
... flat profiles with straight upper and lower incisors, and lesser anterior protrusion of alveolar segments according to features of Caucasian profiles Participants were asked to evaluate the profiles ... Imaging and Graphics ® lateral cephalograms of subjects in natural posture were scanned Lateral cephalogram and profile images of each subject were adjusted using a simulated computer-analysis ... genders, flat profile, (normal or with bimaxillary protrusion) was perceived as the most attractive, whereas lower-jaw prognathism was perceived by all three groups as the least attractive General...
- 7
- 708
- 0
Báo cáo khóa học: Insight into the activation mechanism of Bordetella pertussis adenylate cyclase by calmodulin using fluorescence spectroscopy pptx
... version of the HYDROPRO program [56–58] This program models the surface of proteins as joined beads including the water hydration layer Fig 10 Variation in the average Brownian rotational correlation ... Barzu, O (1991) Structural and ligand-binding properties of a truncated form of Bacillus anthracis adenylate cyclase and of a catalytically inactive variant in which glutamine substitutes for ... also for human serum albumin A Brownian rotational correlation time of ns corresponds to a molecular mass of 1.5 and 1.7 kDa for the HYDROPRO data and the experimental anisotropy decay data, respectively...
- 13
- 409
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... were obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... substitutions affects the targeting pathway of the precursor EXPERIMENTAL PROCEDURES Reagents and biochemicals Restriction enzymes were purchased from either Boehringer Mannheim or Pharmacia MEGAshortscript ... polyclonal PhoE-specific antiserum [31] by SDS/PAGE [32] and visualized by autoradiography In vitro transcription, translation, targeting and cross-linking analysis To generate truncated mRNA, plasmids...
- 8
- 546
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25