0

integrating comparative and functional genomics approaches in a genome information poor species

Báo cáo y học:

Báo cáo y học: " Comparative and functional genomics reveals genetic diversity and determinants of host specificity among reference strains and a large collection of Chinese isolates of the" ppt

Báo cáo khoa học

... and other data analyses JLT, YQH and LZ wrote the paper All authors have read and approved the final manuscript Additional data files The following additional data are available with the online ... common ancestor of xanthomonads and lost from certain Xcc strains at a later stage; IV, inherited from a common ancestor of xanthomonads and degenerated in certain Xcc strains at a later stage Mutational ... mutant was tested on host plants cabbage (B oleracea var capitata) cv Jingfeng-1, Chinese cabbage (B rapa subsp pekinensis) cv Zhongbai-83, Chinese kale (B oleracea var alboglabra) cv Xianggangbaihua,...
  • 26
  • 322
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot

Báo cáo khoa học

... a great deal of training data available, and the statistical methods used are simple and unsophisticated However, we still get a significant improvement on rules alone by adding a trainable component ... 22.2% Table 1: Percentage semantic interpretation errors on in- domain test data for different amounts of training data and different versions of the system Training and test data both in speech ... Training and decoding Training data for ALTERF is supplied in the form of a text file containing one example per line, in the format (Wavfile) (Atoms) (Transcription) where (Wavfile) is the name...
  • 8
  • 461
  • 0
Working pAper series no 1041/ A pril 2009: An economic cApitAl model integrAting credit And interest rAte risk in the bAnking book doc

Working pAper series no 1041/ A pril 2009: An economic cApitAl model integrAting credit And interest rAte risk in the bAnking book doc

Ngân hàng - Tín dụng

... value accounting In line with accounting standards, assets and liabilities are allocated to five repricing buckets as shown in Table A1 For the actual analysis assets, liabilities and off-balance ... economic capital model which takes account of credit and interest rate risk in the banking book The way we set capital against credit and interest rate risk individually is fully in line with standard ... interested in assessing whether setting economic capital in a naïve fashion by adding economic capital against credit risk and economic capital against net interest rate risk (including defaulted coupons)...
  • 57
  • 1,186
  • 0
Báo cáo y học:

Báo cáo y học: "A need for a ‘whole-istic functional genomics’ approach in complex human diseases: arthritis" pptx

Báo cáo khoa học

... using a singular rather than a plural noun, implying that it might be a single process or a type of process The avascular, alymphatic and aneural human OA-affected articular cartilage harboring ... types in the complex interaction and interplay The synovium can be classified and analyzed as normal and hypertrophic, and the latter can be subdivided as cartilage invasive and noninvasive in different ... (synovium, bone and cartilage) and systems (mobile joints in animal models such as rodents and Zebra fish), as well as the interactions that change in the disease state (clinical material and diagnosis)...
  • 4
  • 322
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Ionizing radiation and inhibition of angiogenesis in a spontaneous mammary carcinoma and in a syngenic heterotopic allograft tumor model: a comparative study." pdf

Báo cáo khoa học

... this article as: Riesterer et al.: Ionizing radiation and inhibition of angiogenesis in a spontaneous mammary carcinoma and in a syngenic heterotopic allograft tumor model: a comparative study Radiation ... study, participated in its design and coordination and finalized the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing ... syngenic mammary carcinoma allografts (A) and orthotopic spontaneous mammary carcinomas (B) in response to IR (4 × Gy) and PTK787 (4 × 100 mg/kg) alone and in combination For the allograft tumor model...
  • 6
  • 269
  • 0
 Báo cáo y học:

Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"

Y học thưởng thức

... design and a routine control selection design in a large case-control study that was incorporated into a nationwide mortality survey in China in 1989–1991 As an example, we assessed the hazards ... given indication Our findings revealed that better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers The possible explanations may be: ... death certificate Third, social class, which is also associated with both smoking and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and...
  • 9
  • 532
  • 1
Textile and Apparel Barriers and Rules of Origin in a Post-ATC World

Textile and Apparel Barriers and Rules of Origin in a Post-ATC World

Tài liệu khác

... Textile and Apparel Barriers and Rules of Origin in a Post-ATC World Alan Fox U.S International Trade Commission, Washington, DC William Powers U.S International Trade Commission, Washington, DC Ashley ... land is fixed in all periods, but the rental price can change according to changes in demand 3.2.3 Balance of payments and trade Changes in the balance of payments are also driven by trends in ... real and financial stocks and inter-temporal optimization by economic agents USAGE-ITC distinguishes 523 commodities, 521 industries, 23 foreign regions, and a detailed handling of margins and...
  • 33
  • 498
  • 1
Tài liệu Use Wildcards and Ranges of Values in a SQL Query pdf

Tài liệu Use Wildcards and Ranges of Values in a SQL Query pdf

Cơ sở dữ liệu

... System.Object, ByVal e As System.EventArgs) Handles MyBase.Load GenerateData() End Sub In the class module for the form, add the code in Listing 6.7 to create the GenerateData routine After creating the ... build the data adapter and fill the data table Dim odaResults As New OleDb.OleDbDataAdapter(Me.lblSQLString.Text, BuildCnnStr("(local)", "Northwind")) Dim dtResults As New DataTable() Try odaResults.Fill(dtResults) ... statement, this routine assigns it to the Text property of lblSQLString Then the string is used in a data adapter that was created to fill the dtResults data table Last, the data table is set as...
  • 5
  • 472
  • 0
Optimal security design and dynamic capital structure in a countinous time agency model DEMARZO & SANNIKOV

Optimal security design and dynamic capital structure in a countinous time agency model DEMARZO & SANNIKOV

Kiến trúc - Xây dựng

... Cadenillas, Abel, Jaksa Cvitanic, and Fernando Zapatero, 2003, Dynamic principal-agent problems with perfect information, Working paper, USC Clementi, Gian Luca, and Hugo A Hopenhayn, 2002, A ... time Because the agent can always underreport and steal at rate γR until termination, any incentive compatible strategy yields the agent at least R In contrast, this constraint may bind in a discrete-time ... and start a new firm, as ∆t falls and it becomes easier for the agent to start a new firm, R rises This leads to a decrease in both the credit line and debt Note that as ∆t → ∞ and starting a...
  • 51
  • 561
  • 0
Tài liệu Neural Networks and Neural-Fuzzy Approaches in an In-Process Surface Roughness Recognition System for End Milling Operations pptx

Tài liệu Neural Networks and Neural-Fuzzy Approaches in an In-Process Surface Roughness Recognition System for End Milling Operations pptx

Cơ khí - Chế tạo máy

... empirical representation of the training data set Therefore, a total of 492 data sets were available for training In this research, 92 data sets were selected randomly from the 492 training data In ... review, in addition to communication with leading private industrial research and development laboratories in the state of Iowa (including Winnebago Co in Forest City; Delavan Inc in Des Moines; Sauer-Sundstrand ... Output Spaces into Fuzzy Regions [ ] Assume that the domain intervals of input variable xi are x i– , x i+ , and that the domain intervals of [y –, y+] Each domain interval can be divided into 2N +...
  • 19
  • 539
  • 1
Tài liệu Republican Legal Theory The History, Constitution and Purposes of Law in a Free State ppt

Tài liệu Republican Legal Theory The History, Constitution and Purposes of Law in a Free State ppt

Cao đẳng - Đại học

... judiciary, and a general system of checks and balances, to protect public liberty against corruption and to safeguard the equal individual rights of all citizens against each other and against the state ... political and legal structures of North America and Western Europe, and recently also of South America and Eastern Europe, with growing influence in Asia and Africa, but the theoretical coherence and ... sides in the shallow academic culture wars had approached republican doctrine in the spirit of litigants, quarrying history for partisan advantage, without real interest in learning from the past...
  • 211
  • 750
  • 1
Tài liệu Báo cáo khoa học: Globin gene family evolution and functional diversification in annelids ppt

Tài liệu Báo cáo khoa học: Globin gene family evolution and functional diversification in annelids ppt

Báo cáo khoa học

... CAGGGTCTGCTCGACTCTCTG GCNGAYAAYATHGCNGCNGT GCGGTTAGGGGTGATGTCTC CTGCCCAAGTTCAAGACGC GCNGAYCARATGGCNGCNGTNAA CATCGCCGCCGTGAAG TGTGGAGAAGGGCGGAGA GAGAACAGCACCTGAAGCAAA GGCACAGATTGGCGTCG AAGATATTGCCACCCTCCG ... gt aagt gt aagt gt aagt gt aagt gt agag gt ttgt gt aaag gt aagt gt aagt gt aagt gt aagt gt aagt gt aggt gt aagc gt gaat BP ctray Splicing acceptor yync ⁄ t ag GG ⁄ T ⁄ ctaaa ctaac ataac ctaat ... TGYTGYAGYATHGARGAYCG TTCACTGGTCGCCGTGTCCA AGCACAAGGAGCGTGATGGC CGGTATCGGTGCTGCCC CCAGGCGACGCTCGATGCTG AGCAAGGAGCAAGCTCT CGTGACGGCGTTACCAAAG GAACAAGTGCGAGTGGAGCT GACATCTCGCCAGCCAACA CCTCCAACGGCGGCAAGTTGCC CAGGGTCTGCTCGACTCTCTG...
  • 12
  • 594
  • 0
Tài liệu Design, Lifestyles and Sustainability. Aesthetic Consumption in a World of Abundance pptx

Tài liệu Design, Lifestyles and Sustainability. Aesthetic Consumption in a World of Abundance pptx

Thời trang - Làm đẹp

... circulated; a frantic translation of incoming images into collages of ‘ideal companies’; less frantic but steady attempts to translate those images into the local practices and vice-versa; and once again ... more becoming a matter of practice: eating at particular restaurants, staying at particular hotels or choosing particular means of transportation Cultural capital, in Holt’s interpretation, is ... myriad of tools and concepts embracing presented as tools for achieving sustainability (including initiatives such as LCA, dematerialization, factor four and factor 10, ecological footprints, natural...
  • 13
  • 503
  • 0
Air pollution exposure estimation using dispersion modelling and continuous monitoring data in a prospective birth cohort study in the Netherlands potx

Air pollution exposure estimation using dispersion modelling and continuous monitoring data in a prospective birth cohort study in the Netherlands potx

Điện - Điện tử

... averages In addition, we examined mean maternal PM10 and NO2 exposure levels during total pregnancy according to maternal characteristics and infant characteristics Information on these characteristics ... resulting in an averaged spatially resolved concentration pattern for each wind class Various input data was taken into account in the calculations as described earlier [18,19], including annual data ... home address, using a combination of continuous monitoring data and GIS based dispersion modelling techniques, taking into account both the spatial and temporal variation in air pollution In addition,...
  • 11
  • 514
  • 0
Intellectual Property and Traditional Cultural Expressions in a Digital Environment pptx

Intellectual Property and Traditional Cultural Expressions in a Digital Environment pptx

Cao đẳng - Đại học

... Intelligent Analysis and Information Systems in Germany, an International Fellow of the Yale Law School Information Society Project and has been an International Scholar at the Information Law and Policy ... behind relying on national patent law is revealed by the Ayahuasca Liana case, where da Vine was only patentable because of its slightly modified petal and leaf shape But also approaches relying ... environmental rationality against trade rationality, human rights rationality against the rationality of diplomatic intercourse Thus described, fragmentation of international law would articulate a rather...
  • 344
  • 641
  • 1
a study on awareness and implementation of csr in a multinational companies operating in vietnam

a study on awareness and implementation of csr in a multinational companies operating in vietnam

Sư phạm

... packing materials) In the area of making quality assurance of staff's living standard, a web search “Google" which treats their staff as golden is a best example More than that is many corporations ... not many researchers on the CSR field Many recent years, taking part in many organizations and political economy in the world WTO, ASEAN has attracted many investors and business organizations ... implementation, CSR reporting of CSR in a multinational company operating in Vietnam by asking respondents' understanding and opinion From conducting the research, it is able to show the understanding...
  • 91
  • 795
  • 1
Information Contagion and Inter-Bank Correlation in a Theory of Systemic Risk potx

Information Contagion and Inter-Bank Correlation in a Theory of Systemic Risk potx

Ngân hàng - Tín dụng

... and Mullineaux, 1987) as the formative reason for the commercial-bank clearinghouses in the U.S., and eventually for the Federal Reserve Chari and Jagannathan (1988), Jacklin and Bhattacharya ... playing a coordination game For example, suppose that there are two possible industries in which banks can invest, denoted as and Bank A (B) can lend to firms A1 and A2 (B1 and B2 ) in industries and ... Working Paper No 144, Bank of England, London, UK [29] Jacklin, C and S Bhattacharya (1988) “Distinguishing Panics and Information- based Bank Runs: Welfare and Policy Implications,” Journal of...
  • 49
  • 401
  • 0
Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

Báo cáo khoa học: Thyroid hormone induces the expression of 4-1BB and activation of caspases in a thyroid hormone receptor-dependent manner pptx

Báo cáo khoa học

... amplifying the 4-1BB and TRAF1 cDNAs were: 5¢-GAATTCAAGCTTATGGGA AACAGCTGTTACAACATA-3¢ and 5¢-GAATTCAAG CTTCACAGTTCACATCCTCCTTCTTCT-3¢ for 4-1BB, 5¢-CCCGGGATATCATGGCCTCCAGCTCAGGCAG CAGTC-3¢ and ... 5¢-CCCGGGAAGCTTCGGACCATGG AACAGAAGCCAAGCAAGGTG-3¢ and 5¢-CCCGGG GTCGACGACTTCCTGATCCTCAAAGACCTC-3¢ In order to overexpress 4-1BB and TRAF1 in the HeLaTR cells, the entire coding regions of the 4-1BB and ... protein was fractionated on a polyacrylamide gel and visualized by an image analyzer The arrow indicates the band of human TRa1 protein (C) Reporter luciferase activities induced by T3 HeLaTR and...
  • 10
  • 491
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Integrating surprisal and uncertain-input models in online sentence comprehension: formal techniques and empirical results" pdf

Báo cáo khoa học

... overgeneration from the grammar than in traditional probabilistic parsing Larger grammars also impose a technical burden since parsing uncertain input is in practice more computationally intensive than ... Narayanan, S and Jurafsky, D (2002) A Bayesian model predicts human parse preference and reading time in sentence processing In Advances in Neural Information Processing Systems, volume 14, pages ... significant in both by-participants and by-items ANOVAs (both p < 0.05) and in a linear mixedeffects analysis with participants- and item-specific random interactions (t > 2; see Baayen et al., 2008)...
  • 11
  • 358
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25