Globin gene family evolution and functional diversification in annelids Xavier Bailly 1, * , , Christine Chabasse 1, *, Ste ´ phane Hourdez 1 , Sylvia Dewilde 2 , Sophie Martial 1 , Luc Moens 2 and Franck Zal 1 1 Equipe Ecophysiologie: Adaptation et Evolution Mole ´ culaires, UPMC – CNRS UMR 7144, Station Biologique, BP 74, Roscoff, France 2 Biochemistry Department, University of Antwerp, Belgium Globins are heme-containing proteins that reversibly bind oxygen and other gaseous ligands, and are wide- spread in the three major kingdoms of life [1,2]. Despite the great diversity of their amino-acid sequences, the basic functional unit is assumed to be a monomeric globin with a specific and highly conserved fold referred to as the ‘globin-fold’. On the basis of this conserved basic structure and its prevalence in living organisms, it has been suggested that globin genes evolved from a common ancestral gene which, after successive duplications and speciation events, led to the genes that encode the widespread globin superfamily [1–5]. Three types of globin have been described in anne- lids: (a) noncirculating intracellular globin [e.g. myo- globin (Mb) found in the cytoplasm of muscle cells] [5,6]; (b) circulating intracellular globin [e.g. hemo- globin (Hb) found in erythrocytes] [7]; (c) extracellu- lar globin dissolved in circulating fluids [7,8]. These three types of globin display diversity in sequence, quaternary structure and functions such as binding and transport of oxygen and hydrogen sulfide, and activity of superoxide dismutase and mono-oxygenase [8]. Annelid noncirculating intracellular globins are gen- erally encountered as monomers [9,10], and only the Keywords annelid; dehaloperoxidase; extracellular globin; intracellular globin; myoglobin Correspondence F. Zal, Equipe Ecophysiologie: Adaptation et Evolution Mole ´ culaires, UPMC – CNRS UMR 7144, Station Biologique, BP 74, 29682 Roscoff cedex, France Fax:. +33 (0) 2 98 29 23 24 Tel: +33 (0) 2 98 29 23 09 E-mail: zal@sb-roscoff.fr Present address Department of Cell Biology and Comparative Zoology, Institute of Biology, University of Copenhagen, Denmark *These authors contributed equally to this work (Received 8 December 2006, revised 12 March 2007, accepted 20 March 2007) doi:10.1111/j.1742-4658.2007.05799.x Globins are the most common type of oxygen-binding protein in annelids. In this paper, we show that circulating intracellular globin (Alvinella pom- pejana and Glycera dibranchiata), noncirculating intracellular globin (Areni- cola marina myoglobin) and extracellular globin from various annelids share a similar gene structure, with two conserved introns at canonical positions B12.2 and G7.0. Despite sequence divergence between intracellu- lar and extracellular globins, these data strongly suggest that these three globin types are derived from a common ancestral globin-like gene and evolved by duplication events leading to diversification of globin types and derived functions. A phylogenetic analysis shows a distinct evolutionary history of annelid extracellular hemoglobins with respect to intracellular annelid hemoglobins and mollusc and arthropod extracellular hemoglobins. In addition, dehaloperoxidase (DHP) from the annelid, Amphitrite ornata, surprisingly exhibits close phylogenetic relationships to some annelid intra- cellular globins. We have characterized the gene structure of A. ornata DHP to confirm assumptions about its homology with globins. It appears that it has the same intron position as in globin genes, suggesting a com- mon ancestry with globins. In A. ornata, DHP may be a derived globin with an unusual enzymatic function. Abbreviations DHP, dehaloperoxidase; Hb, hemoglobin; HBL-Hb, hexagonal bilayer hemoglobin; Mb, myoglobin; nMb, nerve myoglobin. FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2641 amino-acid sequences from the polychete, Arenicola marina, [11] and the nucleotide sequence from the polychete, Aphrodite aculeata, [24] have been obtained previously. To date, only cDNA and amino-acid sequences of circulating intracellular Hb belonging to the marine polychete, Glycera dibranchiata, are known [12,13]. Annelid extracellular hexagonal bilayer hemo- globins (HBL-Hbs) are assembled into a large multi- subunit structure with molecular mass of 3–4 MDa. Some nucleotide and amino-acid sequences are already known. Extracellular globin chains are encoded by genes belonging to a multigenic family, the molecular phylogeny of which has previously been studied [15,16]. Only three annelid families are currently known to express simultaneously the three types of globin: the Terebellidae, the Alvinellidae and the Opheliidae [17,18]. The sporadic co-occurrence of the three globin types may be more common in the annelid phylum, as they were probably already present in a common ancestor. Despite studies on the evolution of noncirculating intracellular globins (Mbs) [5] and extracellular globins [16,19,20], the phylogenetic relationships between these different globins in annelids remain unclear because of the lack of available sequences. To understand the emergence and evolution of these globins, we have sequenced new annelid extracellular and intracellular globin polypeptides, cDNAs and genes such as (a) the nucleotide sequences of two extra- cellular globins from the polychete, Ar. marina, (b) the nucleotide sequence of an Ar. marina Mb, (c) the amino-acid and nucleotide sequence of the intracellular circulating globin of the polychete, Alvinella pompejana, (d) the nucleotide sequence of the intracellular circula- ting globin of the polychete, G. dibranchiata, and (e) the nucleotide sequence of dehaloperoxidase A (DHPA) of the marine annelid polychete, Amphitrite ornata. In the light of a molecular phylogeny including intracellular and extracellular globins of annelids, mol- luscs and arthropods, we address here a likely evolu- tionary scenario for the origin of extracellular and intracellular globins in annelids. To complete and strengthen the phylogenetic analy- sis, we also carried out a study on globin gene struc- ture (intron positions), which provides an obvious opportunity to explore gene evolution because genes sharing the same intron positions are thought to be homologous and closely related. The typical pattern of two introns ⁄ three exons (with intron positions in B12.2 and G7.0) already found in numerous eukaryotic glo- bin genes [1] has previously been reported in four annelid extracellular globin genes from Lumbricus terrestris [21], Eudystilia vancouverii [22] and Riftia pachyptila [23]. Apart from the nerve myoglobin (nMb) of Aph. aculeata in which the first intron is missing [24], neither intracellular circulating nor non- circulating globin gene structures are known. For this survey, we have identified (a) gene structures of the two new extracellular globins from Ar. marina, (b) the gene structures of four extracellular globins from the vestimentiferan, R. pachyptila, (c) the gene structure of Ar. marina Mb, (d) the gene structure of the new intra- cellular circulating globin from Al. pompejana, (e) the gene structure of intracellular circulating globin from G. dibranchiata, and (f) the gene structure of DHPA from A. ornata. Interestingly, blast searches revealed a strong amino-acid similarity between intracellular Hbs from Al. pompejana and DHP from A. ornata involved in halometabolite detoxication (converts halogenated phenols into quinones in the presence of hydrogen per- oxide) [25]. These heme-containing enzymes exhibit conserved distal and proximal histidines found in most globin sequences [26], and the crystal structure of native DHP exhibits a typical globin fold [27]. These data suggest that DHP activity may have arisen by duplication of a globin gene [27], but do not rule out a possible evolutionary convergence. In this paper, we also show that this annelid DHP protein illustrates an original case of functional diversification from a globin. Results Identification of the A2 and B2 extracellular globin chains of Ar. marina Two extracellular globin chains of Ar. marina (acces- sion numbers AJ880690 and AJ880691 for cDNAs, Q53I65 and Q53I64 for amino-acid sequences) were aligned and compared with other globins in the mul- tiple sequence alignment (Fig. 1 and Table 1). The sequence of the extracellular globin from Lumbricus terrestris [28] was used as reference for the helix assignment (Fig. 1). These two new globin chains pos- sess the well-conserved globin amino acids, Pro-C2, Phe-CD1, His-F8 and Trp-H4, as well as the two cysteines NA2 and H7 known to be involved in the formation of an intrachain disulfide bridge [29,30]. Strong molecular signatures and phylogenetic analyses allowed the unambiguous assignment of these two new globin chains to A2 and B2 extracellular Hb clusters according to the classification proposed by Suzuki et al. [31] in which the A and B families are, respectively, subdivided into A1, A2 and B1, B2 sub- families. Functional diversification in annelid globin family X. Bailly et al. 2642 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS A2 chain This sequence contains an ORF of 157 codons (inclu- ding the initiation codon). As in other annelid extracel- lular globins, residues 1–16 correspond to a signal peptide. This signal peptide was removed in the align- ment presented in Fig. 1. This sequence clearly belongs to the A family, as evidenced by typical molecular features: Lys-A9, Trp-B10 and also a deletion of three residues between the A and B helices, and a deletion of one residue between the F and G helices. Moreover, the two residues Gly-Pro (at position A1-A2) indi- cate that this sequence belongs to the A2 group (Fig. 1). B2 chain This sequence contains an ORF of 165 codons (inclu- ding the initiation codon). Residues 1–16 correspond to a signal peptide. This signal peptide is not shown in the alignment (Fig. 1). This sequence exhibits amino acids that are typical of the B family: Asp-A4, Trp-A16, Phe-B10 and Leu- B13. Furthermore, it shows an insertion of three resi- dues between the A and B helices, an insertion of one residue between the F and G helices, and a three-resi- due motif Pro-Gln-Val at position G17-19. Moreover, the three-residue motif Thr-Gly-Arg between the A and B helices indicates that this sequence belongs to the B2 group (Fig. 1). Fig. 1. Multiple alignment of annelid DHP, extracellular and intracellular globins (circula- ting and noncirculating) amino-acid sequences. Intracellular globin sequences are shaded. Positions of intron 1 (B12.2) and 2 (G7.0) are indicated by dashed lines. The conserved amino-acid residues are indicated in black. Letters above the sequence indi- cate the helical designation, based on the Lumbricus terrestris helical structure [28]. Signal peptides, when present, have been removed. See Table 2 for abbreviations. X. Bailly et al. Functional diversification in annelid globin family FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2643 Intracellular circulating globin of Al. pompejana The partial cDNA sequence (accession number AJ880693) was obtained using degenerate primers designed from the amino-acid sequence obtained by Edman degradation. This sequence displays the key residues as Pro-C2, Phe-CD1, His-F8 and Trp-H4 (Fig. 1). However, as in Ar. marina myoglobin MbIIa and A. ornata DHP, the conserved Trp-A12 is replaced by an Ile residue. Gene structure Introns were sequenced and characterized for Ar. mar- ina A2 and B2 extracellular globins (accession numbers AJ880690 and AJ880691, respectively) and myoglobin MbIIa (accession number AJ880692), the extracellular A1, B1a, B1b and B1c globin chains from R. pachypti- la, intracellular Hb from Al. pompejana, Hb mIV from G. dibranchiata, and DHPA from A. ornata. Bailly reported the intron position of R. pachyptila A2 and B2 [23]. The position and length of each intron are summarized in Table 2. For all the sequences, the insertion positions of the two introns correspond to the usual B12.2 and G7.0 positions previously reported for many other globin sequences including L. terrestris [32] and E. vancouverii globins [1,22] (Fig. 1). The splicing sites have also been analyzed: it was shown that the 5¢ splice donor is marked by an eight- nucleotide conserved sequence, the 3¢ acceptor site cor- responds to a pyrimidine-rich region of 11 nucleotides followed by (C ⁄ T)AG, and the typical branch point signal corresponds to a five-nucleotide sequence that functions as a signal for the spliceosome [33,34]. In all introns, splicing donor and acceptor sequences con- form to the consensus sequences (Table 2). Phylogenetic relationships The Bayesian tree based on annelid globin sequences only is shown in Fig. 2. The NJ tree shows a similar topology (data not shown). Two well-supported main clusters can be identified: one comprises all intracellu- lar globins and the other all the extracellular globins. The intracellular cluster includes the nerve myoglobin (nMb) and all Mbs and intracellular Hbs. The extra- cellular cluster is divided into two groups: the A and B families [15], as expected. Al. pompejana intracellular Hb and A. ornata DHP are most closely related to each other and obvi- ously belong to a well-supported intracellular cluster, distinct from a second cluster of intracellular globins which includes G. dibranchiata Hb and Aph. aculeata nMb. In Fig. 3, which includes annelid, mollusc and arth- ropod globins, annelid extracellular and intra- cellular globins do not cluster together, but annelid Table 1. Globin amino-acid sequences shown in the multiple align- ment and molecular phylogeny. Species Abbreviation Accession number Amphitrite ornata DHP-Amph Q9NAV8 Arenicola marina A2a-Are a Q53I65 B2-Are a Q53I64 MbIa-Are Kleinschmidt [11] Alvinella pompejana HbInt-Alv a Q53I62 Aphrodite aculeata NMb-Aph Q93101 Eudistylia vancouverii A1-Eud Q9BKE9 Glycera dibranchiata mIV-Gly P022 16 P1-Gly P23216 Lamellibrachia sp. A2-Lam P15469 B1-Lam Q7Z1R4 B2-Lam Q86BV3 Lumbricus terrestris A1-LumT P08924 A2-LumT P022 18 B1-LumT P11069 B2-LumT P13579 Ophelia bicornis Mb-Oph Q56JK7 Pheretima hilgendorfi A1-Phehil P83122 Pheretima sieboldi A1-Phesie P11740 Riftia pachyptila A1-Rif Q8IFK4 A2-Rif P80592 B1b-Rif Q8IFK1 B2-Rif Q8IFJ9 Sabella spallanzanii A2-Sab Q9BHK1 B2a-Sab Q9BHK3 Tubifex tubifex A1-Tub P18202 Tylorrhynchus heterochaetus A1-Tyl P02219 A2-Tyl P09966 B2a-Tyl P13578 Buccinum undatum BuccMb Q7M424 Nassarius mutabilis NassaMb P31331 Scapharca inaequivalvis ScaHb1 Q26505 Anadara trapezia HBIaAna P14395 HBIIAna P14394 Barbatia lima BarbHBD Q17157 Biomphalaria glabrata HBD2Biom and HBD3Biom Q683R3 Artemia sp. Hb1Art to HB9Art Q7M454 E1ART P19363 E7ART P19364 Chironomus thummi thummi B1CHITH P02221 B2CHITH P02222 B6CHITH P02224 B7CHITH P12550 B8CHITH Q23763 B9CHITH P02223 a New sequences presented in this work. Functional diversification in annelid globin family X. Bailly et al. 2644 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS intracellular globins are at the base of a cluster com- posed of extracellular globins from the insect, Chirono- mus thummi thummi. The extracellular globin family of the other arthropod, Artemia salina, surprisingly clus- ters independently of C. thummi thummi. This topology illustrates the high level of divergence among extracel- lular globin families between crustacean and insects in the Arthropoda phylum, reflecting specific adaptations. This is particularly obvious when the exon ⁄ intron structures of arthropod globin genes (summarized in [35]) are compared, showing the presence of the canon- ical B12.2 and G7.0 introns position in the Artemia crustacean and their absence in the Chironomus insects. Discussion Annelid globin gene structure All introns described in this article exhibit the splicing donor GT and acceptor AG sites (Table 2), whereas in the L. terrestris B1 globin gene, the donor GT is replaced by GC [32]. The typical branch point sequence, involved in spliceosome binding, sometimes diverges from the standard consensus sequence (CTRAY), but studies have shown that this consensus sequence may not reflect the majority of branch point signals [34]. We used the intron insertion position pattern as ref- erence in order to follow gene evolution relationships. We assume that identical intron position between genes is a strong argument to reject evolutionary convergence between proteins exhibiting structural similarity. We have shown that R. pachyptila and Ar. marina extracellular globins (A2 and B2), Ar. marina Mb and Al. pompejana and G. dibranchiata intracellular Hb all share the same typical two intron ⁄ three exon pattern (Table 2). These results allow us to rule out the possi- bility of structural and functional convergence between circulating and noncirculating intracellular globin and extracellular globin genes in annelids: these genes prob- ably evolved from a common globin-like gene ancestor and did not emerge independently of unrelated genes. All the annelid intracellular globin gene structures reported here show the same gene structure, whereas Aph. aculeata nMb gene lacks the first intron [24]. This might be explained by the loss of the first intron in the Aph. aculeata nMb evolutionary lineage [24]. Table 2. Position, length of introns, exon ⁄ intron splice junctions and possible branch points in Ar. marina, Al. pompejana, R. pachyptila, G. di- branchiata globins and A. ornata globin and DHP genes. Sequences in italic correspond to branch points where the well-conserved C or T or A is not found. BP, Branch point. The consensus sequences presented are from Mount et al. [33,52]. Consensus Globin ⁄ DHP Intron Position Size (bp) Splicing donor A ⁄ C AG gt a ⁄ g agt BP ctray Splicing acceptor yyn c ⁄ t ag G G ⁄ T Ar. marina A2 Intron 1 B12.2 370 GGC gt taagt ⁄ ctgt ag TA Intron 2 G7.0 773 GAT gt aagt ctaaa ctat ag CT B2 Intron 1 B12.2 487 GGA gt aagt ctaac ttac ag CC Intron 2 G7.0 495 GAC gt aagt ataac ctgc ag GA R. pachyptila A2 Intron 1 B12.2 495 CCA gt gagt ctaat ttgc ag TG Intron 2 G7.0 639 GAC gt aagc cttat cctc ag AC B2 Intron 1 B12.2 531 GAC gt aagc cttaa ttgc ag CC Intron 2 G7.0 390 TCT gt gagt ctgac ttgc ag CC A1 Intron 1 B12.2 505 AAA gt aagt cttat tgac ag CG Intron 2 G7.0 473 GTT gt aagt gtcat ttgc ag GT B1a Intron 1 B12.2 1183 CGA gt aagt ctcac catc ag GC Intron 2 G7.0 947 GGA gt aagt ctaat tttc ag GC B1b Intron 1 B12.2 601 GTA gt aagt ctgac tcac ag CA Intron 2 G7.0 655 CAG gt agag ttaat ttgc ag CT B1c Intron 1 B12.2 1029 CAG gt ttgt ctgac ttgc ag AT Intron 2 G7.0 489 CAG gt aaag ctaac ttgc ag GT Al. pompejana Hb Intron 1 B12.2 135 GGA gt aagt ctaac accc ag GT Intra Intron 2 G7.0 241 GCT gt aagt ctaac tttc ag GA Ar. marina Mb Intron 1 B12.2 301 CTT gt aagt ctcaa ccac ag CC Intron 2 G7.0 500 ACT gt aagt ctgac cgcc ag GA G. dibranchiata mIV Intron 1 B12.2 978 CAA gt aagt ttgat tttc ag GT Intron 2 G7.0 912 GAG gt aggt ataac tttc ag CC A. ornata DHP Intron 1 B12.2 110 CGC gt aagc ctcat ctgc ag AT Intron 2 G7.0 2424 GAG gt gaat atgac cttc ag AA X. Bailly et al. Functional diversification in annelid globin family FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2645 Distinct evolutionary history of extracellular globins with respect to intracellular globins in annelids Working in the field of comparative biochemistry and especially on intracellular hemerythrins and hemo- globins, Manwell & Baker [36] drew attention to a neglected problem in annelid globin evolution: ‘The transition between intracellular and extracellular res- piratory proteins represents a profound evolutionary accomplishment. It is much more than placing an appropriate signal polypeptide portion, labeling a pro- tein for extracellular export.’ Molecular signatures (Fig. 1) clearly indicate that circulating and noncirculating intracellular globins share more common features among them than with extracellular globins. Phylogenetic analyses (Fig. 2) show that these intracellular globins cluster independ- ently of extracellular globins, with high bootstrap values (NJ method, data not shown). This strongly suggests that extracellular globin lineages have a dis- tinct evolutionary history with respect to circulating and noncirculating intracellular globins. Experiments performed on the polychete, Travisia japonica,by Fushitani et al. [37] showed that antibodies against extracellular globins did not cross-react with intracellu- lar globins. This supports early or rapid divergence between intracellular and extracellular globin lineages. Globins are found in many unicellular organisms such as archae, eubacteria and lower eukaryota [2,38– 40]. The acquisition of a signal peptide for the secre- tion of extracellular globins is probably an apomorphic characteristic in multicellular organisms with respect to unicellular ones. It has been proposed that the secre- tory peptide may have been acquired by insertion of some other secreted protein gene by genetic recombi- nation [41,42]. Therefore, the secretory peptide found in all annelid extracellular globins must have been Fig. 2. Bayesian phylogenetic tree based on annelid extracellular and intracellular globins (circulating and noncirculating) and DHP amino-acid sequences. Posterior probability values are indicated above the branches. Functional diversification in annelid globin family X. Bailly et al. 2646 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS acquired by the original ancestral globin gene, which has duplicated to give rise to the extracellular globin multigenic family in this phylum (it is not parsimoni- ous to envisage a repeated peptide signal acquisition in the extracellular globin multigenic family). Even though acquisition of a signal peptide must have been a determinant step, other features are specific to annelid extracellular globins. Extracellular state seems to correlate with the formation of a high-molecular- mass complex, limiting the protein’s contribution to the total colloid osmotic pressure of body fluids (vascular blood and coelomic fluids) [43] and to minimizing rapid Hb loss by excretion. It is clear that the evolutionary elaboration of the HBL-Hb structure simultaneously involved the possibility for globins and linkers (proteins involved in the structure of HBL-Hb) to interact and to bind to dimers or other aggregation states while conser- ving functionality. Indeed, linkers are thought to result from duplication of globins and rearrangement of exons [41]. It has been suggested that these ‘nonoxygen-bind- ing subunits’ may also intrinsically possess superoxide dismutase and ⁄ or methemoglobin reductase activities necessary to keep the Hb functional [36]. Evolution of HBL-Hbs implies the coevolution of extracellular glo- bins and linkers, which also represents a unique feature of annelids with respect to other living organisms. Mol- luscs and arthropods, which also sometimes express extracellular Hbs, do not exhibit a HBL-Hb quaternary structure and do not possess linkers. Arthropod extra- cellular globin sequences also exhibit a signal peptide, but possess neither internal disulfide bridge nor HBL- Hb quaternary structure, which suggests a different evo- lutionary history from extracellular globins in annelids. In addition, annelid extracellular globins do not cluster together with arthropod and mollusc extracellular glo- bins as shown in Fig. 3. To date, it is not possible to state whether annelid, arthropod and mollusc extracel- lular globins come from an extracellular globin already present in a common ancestor before their radiation. Showing a clear homology between these extracellular globins would require additional globin sequences. However, in the Annelida phylum, the HBL-Hb extracellular globins represent a phylum-specific inno- vation, and the common gene structure shared between all annelid globin types attest that extracellular globins are homologous with the intracellular ones. This rules out functional and structural convergence occurring by a gene co-option process. DHP is a derived globin A. ornata DHP, Al. pompejana intracellular Hb and Ar. marina Mb exhibit obvious molecular sig- natures between each other and with the intracellular Fig. 3. Bayesian phylogenetic tree based on annelid, mollusc and arthropod extracellular and intracellular globins and DHP amino-acid sequences. Posterior probability values are indicated above the branches. X. Bailly et al. Functional diversification in annelid globin family FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2647 monomeric globin N-terminal sequence of the poly- chete, Enoplobranchus sanguineus [44]. These results, suggesting a close relationship between DHP and intracellular globin, are supported by molecular phylo- genic analyses showing that A. ornata DHP, Al. pom- pejana intracellular Hb, Ar. marina Mb and Ophelia bicornis Mb cluster together with high bootstrap values, with respect to other intracellular globins (G. dibranchiata and Aph. aculeata nMb) and extra- cellular globins. Interestingly, we have found that, in A. ornata, the DHP-encoding gene exhibits the same gene structure as extracellular globins, Ar. marina Mb and intracellular globin from Al. pompejana and G. dibranchiata. The conserved intron positions between the three annelid globin types and DHP, the DHP globin fold and the amino-acid similarities between protein sequences including globin and DHP allow us to rule out structurally convergent evolution and indicate the homology (i.e. common ancestry) of these genes. In addition, like other typical globins, A. ornata DHP is able to reversibly bind oxygen. It is found in the oxy- ferrous (Fe 2+ ) state when natively purified [26] and also exhibits a globin fold, a heme group and distal histidine [26,27]. We have confirmed by a molecular genetic approach that DHP is a globin with a derived function, using its heme to bind the peroxide ligand in order to cata- lyze the oxidative dehalogenation of polyhalogenated phenols. The DHP function, derived from a canonical globin structure encoded by a globin-like gene, may have been an innovation selected after annelid radiation from an oxygen carrying Hb as an adaptation driven by selection based on territorial war between annelids excreting halogenous compounds [25]. A. ornata possesses a monomeric circulating Hb in its coelomic circulating cells [45], but the amino-acid sequence is still unknown. It is not possible to state whether DHP and intracellular Hb of A. ornata are the same protein. Further molecular studies are needed to confirm whether they are the same protein with several functions or the result of gene duplication with subsequent acquisition of a new function. Experimental procedures Collection of biological material Juvenile specimens of the lugworm, Ar. marina, were collec- ted at low tide from a sandy shore near Roscoff (Penpoull Beach), Nord Finiste ` re, France, and kept in local running sea water for 24 h. Specimens of Al. pompejana were collected at 2500 m depth on the East Pacific Rise (9°50¢N at the M-vent site) by the manned submersible Nautile during the HOPE¢99 cruise. Once on board, the animals were kept in chilled sea water (10 °C) until used for tissue collection (usually less than 5 h). Tissues were then frozen in liquid nitrogen until they were used. Specimens of the hydrothermal vent tube worm, R. pachyptila, were collected on the EPR (9°50¢N at the Riftia Field site) at a depth of about 2500 m, during the French oceanographic cruise HOT 96 and the American cruise LARVE’99. The worms were sampled using the tele- manipulated arms of the submersibles Nautile and Alvin, brought back alive to the surface inside a temperature-insu- lated basket, and immediately frozen and stored in liquid nitrogen after their recovery on board. Specimens of A. ornata were collected at Debidue flats, in the North Inlet estuary (Georgetown, SC, 33°20¢N, 79°10¢W) and immediately placed in 70% alcohol until used for DNA extraction. Specimens of G. dibranchiata were collected in Maine, USA and immediately preserved in 70% alcohol until used for DNA extraction. Preparation of Al. pompejana intracellular Hb Coelomic fluid was collected by carefully opening the dorsal body wall in the middle part of the body. The coelomic fluid was centrifuged at 1000 g for 3 min at 4 °C, and the cells were washed twice with filtered sea water. After the last cen- trifugation, three volumes of distilled water were added to the pellet of cells obtained, inducing cell lysis. The suspension obtained was then centrifuged at 10 000 g for 5 min at 4 °C. The supernatant, containing the cell extract, was then separ- ated and frozen in liquid nitrogen. To prevent hydrolysis by proteases, phenylmethanesulfonyl fluoride was added to a final concentration of 1 lmolÆL )1 before freezing. Intracellu- lar Hb was prepared as previously described [18]. Protein sequencing of Al. pompejana intracellular Hb Heme was extracted by acid acetone precipitation. ‘De-hemed’ Hb was pyridylethylated as described by Allen [46] and subsequently dialysed against 0.1% trifluoroacetic acid. The protein was modified with maleic anhydride and cleaved with trypsin and CNBr. An Asp-Pro cleavage was performed as described by Allen [46]. The tryptic peptides were separated by HPLC on a reversed-phase Vydac C4 column developed with 0.1% trifluoroacetic acid ⁄ acetonitrile. The CNBr and Asp-Pro peptides were separated by SDS ⁄ PAGE [47], and subjected to electroblot- ting. The peptides were sequenced in an ABI 471-B sequencer (Applied Biosystems, Foster City, CA, USA) Functional diversification in annelid globin family X. Bailly et al. 2648 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS operated as recommended by the manufacturer. The N-terminal sequence was obtained by subjecting intact Hb to Edman degradation. Total RNA extraction and cDNA synthesis Entire juvenile specimens of Ar. marina and Al. pompejana were crushed in liquid nitrogen. Total RNA was extracted using RNAbleÒ buffer (Eurobio, Courtaboeuf, France), and poly(A) RNA was then isolated using an mRNA Puri- fication KitÒ (Amersham, Little Chalfont, Buckingham- shire, UK). RT-PCR was carried out using an anchor 5¢-CTCCTCTCCTCTCCTCTTCC(T) 17 primer. Isolation of genomic DNA Whole specimens of Ar. marina, Al. pompejana, R. pachypti- la, G. dibranchiata and A. ornata were washed in deionized water, and then incubated in 700 lL PK Buffer (50 mm Tris ⁄ HCl, 100 mm NaCl, 25 mm EDTA and 1% SDS, pH 8) with 15 lL Proteinase K (10 lgÆlL )1 )at65°C for 1 h. The supernatant was separated by centrifugation at 12 000 g for 5 min at 4 °C, and added to 700 lL phenol. The DNA was separated by a standard phenol ⁄ chloroform extraction. The resulting DNA was precipitated with propan-2-ol, kept at )20 °C overnight, and centrifuged at 12 000 g for 15 min. The pellet was then washed once with 75% ethanol. Finally, the DNA pellet was resuspended in 100 lL TE buffer (10 mm Tris ⁄ HCl, 0.1 mm EDTA, pH 8) and stored at 4 °C until used. Amplification of cDNA and genomic DNA PCR was carried out in a total volume of 25 lL containing 10–50 ng template cDNA ⁄ gDNA, 100 ng each degenerate primer, 200 lm dNTPs, 2.5 mm MgCl 2 and 1 U DNA polymerase (Uptima, Interchim, Montluc¸ on, France). PCR conditions were as follows: an initial denaturation step at 95 °C for 5 min, 35 cycles consisting of denaturation at 95 °C for 30 s, annealing for 30 s, extension at 72 °C for 40 s, and a final elongation step at 72 °C for 10 min. Prim- ers are given in Table 3. Cloning and sequencing The PCR products were cloned using a TOPOÒ-TA cloning Kit (Invitrogen, Cergy Pontoise, France). The pos- itive recombinant clones were isolated, and plasmid DNA was prepared with the FlexiPrep Kit (Amersham). Purified plasmids containing the putative globin insert were used in a dye–primer cycle sequencing reaction, using the primer T7 and the Big DyeÒ Terminator V3.1 Cycle Sequencing kit (Applied Biosystems). PCR products were subsequently run on a 3100 Genetic Analyser (Applied Biosystems) at Roscoff Sequencing Core Facility Ouest GenopoleÒ Plateform. Table 3. Primer sequences used for the PCR amplification. CDS, Coding sequence. Species Forward (5¢ to 3¢) Reverse (5¢ to 3¢) Ar. marina A2 CDS GARTGYGGNCCNTTRCARCG CCANGCNTCYTTRTCRAAGCA Intron 1 GTCAGGGACGAGGCCGGA ACTCTCTTGAAGAGAGCCCG Intron 2 GCACGTAGAAAGGCACATCC GCTGGGGGCATACTCCATCA B2 CDS TGYTGYAGYATHGARGAYCG CANGCNYCNGRRTTRAARCA Intron 1 TTCACTGGTCGCCGTGTCCA TTCTTGGACTCGGGGTCGC Intron 2 AGCACAAGGAGCGTGATGGC TGCTGACCTGGGGCATGAC R. pachyptila A1 Intron 1 CGGTATCGGTGCTGCCC TGTCTTTGGAGTTGACACTTTCG Intron 2 CCAGGCGACGCTCGATGCTG TGGCACGTCGAAGCAGACG B1a Intron 1 AGCAAGGAGCAAGCTCT GTGAACAGATTCTTGGC Intron 2 CGTGACGGCGTTACCAAAG AGGCGTCGGGGTTGAATC B1b Intron 1 GAACAAGTGCGAGTGGAGCT TAAACAACTGTTTAGCCGC Intron 2 GACATCTCGCCAGCCAACA CGACGACCTGAGGAAGCAA B1c Intron 1 CCTCCAACGGCGGCAAGTTGCC TGAAGAGGTTCTTGGCAGTGG Intron 2 CAGGGTCTGCTCGACTCTCTG CGATAAGCTGAGGCATCACC Al. pompejana Hb Intra CDS GCNGAYAAYATHGCNGCNGT RTTRTANGCYTGYTCCCANGC Intron 1 GCGGTTAGGGGTGATGTCTC GCGTCTTGAACTTGGGCAG Intron 2 CTGCCCAAGTTCAAGACGC GTTCCCATGCAGCCGAGT Ar. marina Mb CDS GCNGAYCARATGGCNGCNGTNAA CNCCNGTNGCNGCNGTCCA Intron 1 CATCGCCGCCGTGAAG TGGCAACAGAGCCCAAAGA Intron 2 TGTGGAGAAGGGCGGAGA GGCCAGGAAGGGGACGA G. dibranchiata mIV Intron 1 GAGAACAGCACCTGAAGCAAA CCATCTGTGCCAACACTTTC Intron 2 GGCACAGATTGGCGTCG AGCAGTGACGCACCCAGA A. ornata DHP Intron 1 AAGATATTGCCACCCTCCG GGTCAGATTTGCCGACATAGTT Intron 2 CACTCGTCCAGATGAAACAGC CGCGGAGACCAAATTCTTG X. Bailly et al. Functional diversification in annelid globin family FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2649 Rapid amplification of cDNA ends cDNA ends were obtained by PCR using the 5¢-RACE and 3¢-RACE kit (Roche, Grenzacherstrasse, Switzerland) according to the manufacturer’s instructions. Buffer, rea- gents and other conditions for the nested PCR were as described by the manufacturer. The RACE products were purified, cloned with the TOPO-TA cloning kit (Amersham), and sequenced as described above. Sequence analyses Signal peptide The peptide signal cleavage site was predicted by the SignalP 3.0 Server [48] (http://www.cbs.dtu.dk/services/ SignalP). Database analysis The tblastn and tblastx search algorithms [49] were employed to search data on the Uniprot database (http:// www.ebi.ac.uk). Globin multiple alignment We performed a global multiple alignment including anne- lid, mollusc and arthropod intracellular and extracellular globins. We present here only the annelid globin multiple alignment; the global one including molluscs and arth- ropods is available on request. All the globin sequences used in the multiple alignment are listed in Table 1. Amino-acid sequences were aligned with the program muscle [50] (http://phylogenomics.berkeley.edu/cgi-bin/ muscle/input_muscle.py) and adjusted manually. Molecular phylogeny For the two sets of aligned globins (annelids on one hand and annelids, molluscs and arthropods on the other), Baye- sian analysis was carried out using mrbayes 3.1.1 (http:// mrbayes.csit.fsu.edu/index.php) and the JTT transition mat- rix [51]. Four chains were run simultaneously for 10 6 gener- ations, and trees were sampled every 100 generations, producing a total of 10 4 trees. Acknowledgements We thank Dr Joa ˜ o Gil for collecting specimens of G. dibranchiata, and Dr David Lincoln for collecting specimens of A. ornata. We gratefully acknowledge the captain and crew of the NO L’Atalante, the pilots and groups of the French and US submersibles Nautile and Alvin, respectively. We are also very grateful to the chief scientists of the HOT’96, LARVE’99 and HOPE’99 oceanographic cruises. This work was sup- ported by CNRS, European grant (FEDER no. pres- age 3814) and the Conseil Re ´ gional de Bretagne (contract no. 809) (FZ). SD is a postdoctoral fellow of the FWO (Fund for Scientific Research Flanders). References 1 Hardison R (1998) Hemoglobins from bacteria to man: evolution of different patterns of gene expression. J Exp Biol 201, 1099–1117. 2 Vinogradov SN. et al. (2005) Three globin lineages belonging to two structural classes in genomes from the three kingdoms of life. Proc Natl Acad Sci USA 102, 11385–11389. 3 Goodman M. et al. (1988) An evolutionary tree for invertebrate globin sequences. J Mol Evol 27, 236–249. 4 Moens L. et al. (1996) Globins in nonvertebrate species: dispersal by horizontal gene transfer and evolution of the structure–function relationships. Mol Biol Evol 13, 324–333. 5 Suzuki T & Imai K (1998) Evolution of myoglobin. Cell Mol Life Sci 54, 979–1004. 6 Wittenberg JB (1970) Myoglobin-facilitated oxygen dif- fusion: role of myoglobin in oxygen entry into muscle. Physiol Rev 50, 559–636. 7 Vinogradov SN, Walz DA, Pohajdak B, Moens L, Kapp OH, Suzuki T & Trotman CN (1993) Adventi- tious variability? The amino acid sequences of nonverte- brate globins. Comp Biochem Physiol B 106, 1–26. 8 Weber RE & Vinogradov SN (2001) Nonvertebrate hemoglobins: functions and molecular adaptations. Phy- siol Rev 81, 569–628. 9 Wittenberg BA, Briehl RW & Wittenberg JB (1965) Haemoglobins of invertebrate tissues. Nerve haemo- globins of Aphrodite, Aplysia and Halosydna. Biochem J 96, 363–371. 10 Terwilliger RC, Garlick RL & Terwilliger NB (1980) Characterization of hemoglobins and myoglobin of Travisia foetida. Comp Biochem Physiol 66B, 261–266. 11 Kleinschmidt T & Weber RE (1998) Primary structures of Arenicola marina isomyoglobins: molecular basis for functional heterogeneity. Biochim Biophys Acta 1383, 55–62. 12 Zafar RS, Chow LH, Stern MS, Scully JS, Sharma PR, Vinogradov SN & Walz DA (1990) The cDNA sequences encoding two components of the polymeric fraction of the intracellular hemoglobin of Glycera dibranchiata. J Biol Chem 265 , 21843–21851. 13 Zafar RS, Chow LH, Stern MS, Vinogradov SN & Walz DA (1990) The heterogeneity of the polymeric intracellular hemoglobin of Glycera dibranchiata and the cDNA-derived amino acid sequence of one component. Biochim Biophys Acta 1041, 117–122. Functional diversification in annelid globin family X. Bailly et al. 2650 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS [...]... didomain hemoglobin: structure and evolution of polymeric hemoglobins and their coding genes Mol Biol Evol 16, 1208–1218 36 Manwell C & Baker CMA (1988) Magelona haemerythrin: tissue specificity, molecular weights and oxygen equilibria Comp Biochem Physiol 89B, 453–463 37 Fushitani K, Ochi O & Morimoto H (1982) Purification, characterization, and comparison of extracellular hemoglobins in coelomic fluid and. .. Functional diversification in annelid globin family 41 42 43 44 45 46 X Bailly et al genes reveal frequent lateral gene transfers affecting eukaryotes Curr Biol 13, 94–104 Riggs AF (1991) Aspects of the origin and evolution of non-vertebrate hemoglobins Am Zool 31, 535–545 Williams EJ, Pal C & Hurst LD (2000) The molecular evolution of signal peptides Gene 253, 313–322 Toulmond A (1992) Properties and functions... Heterogeneity of the hemoglobin from the common bloodworm Glycera dibranchiata J Biol Chem 246, 1700–1705 15 Gotoh T, Shishikura F, Snow JW, Ereifej KI, Vinogradov SN & Walz DA (1987) Two globin strains in the giant annelid extracellular haemoglobins Biochem J 241, 441–445 16 Bailly X, Jollivet D, Vanin S, Deutsch J, Zal F, Lallier F & Toulmond A (2002) Evolution of the sulfide-binding function within... histidine as their proximal heme iron ligand Biochemistry 36, 2197–2202 Functional diversification in annelid globin family 27 LaCount MW, Zhang E, Chen YP, Han K, Whitton MM, Lincoln DE, Woodin SA & Lebioda L (2000) The crystal structure and amino acid sequence of dehaloperoxidase from Amphitrite ornata indicate common ancestry with globins J Biol Chem 275, 18712–18716 28 Strand K, Knapp JE, Bhyravbhatla B... JR & Riggs AF (1988) Exon-intron organization in genes of earthworm and vertebrate globins Science 240, 334–336 33 Keller EB & Noon WA (1984) Intron splicing: a conserved internal signal in introns of animal pre-mRNAs Proc Natl Acad Sci USA 81, 7417–7420 34 Harris NL & Senapathy P (1990) Distribution and consensus of branch point signals in eukaryotic genes: a computerized statistical analysis Nucleic... hemoglobins in Archaea Proc Natl Acad Sci USA 101, 6675–6680 39 Zhu H & Riggs AF (1992) Yeast flavohemoglobin is an ancient protein related to globins and a reductase family Proc Natl Acad Sci USA 89, 5015–5019 40 Andersson JO, Sjogren AM, Davis LA, Embley TM & Roger AJ (2003) Phylogenetic analyses of diplomonad FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2651 Functional. .. multi-subunit extracellular annelid hemoglobins Zool Sci 7, 1–16 21 Jhiang SM & Riggs AF (1989) The structure of the gene encoding chain c of the hemoglobin of the earthworm, Lumbricus terrestris J Biol Chem 264, 19003–19008 22 Dewilde S, Van Hauwaert ML, Vinogradov S, Vierstraete A, Vanfleteren J & Moens L (2001) Protein and gene structure of a chlorocruorin chain of Eudistylia vancouverii Biochem Biophys... functional properties of intracellular and extracellular hemoglobins Physiol Biochem Zool 73, 365–373 19 Negrisolo E, Pallavicini A, Barbato R, Dewilde S, Ghiretti-Magaldi A, Moens L & Lanfranchi G (2001) The evolution of extracellular hemoglobins of annelids, vestimentiferans, and pogonophorans J Biol Chem 276, 26391–26397 20 Gotoh O & Suzuki T (1990) Molecular assembly and evolution of multi-subunit... Sullivan B & Bonaventura J (1975) The role of coelomic and vascular hemoglobin in the annelid family terebellidae Comp Biochem Physiol A 51, 281–294 Allen G (1989) Sequencing of proteins and peptides In Laboratory Techniques in Biochemistry and Molecular 2652 47 48 49 50 51 52 Biology (Burdon RH, Van Knippenberg PH, eds), Vol 9, pp 73–104 Elsevier North Holland, Amsterdam Swank RT & Munkres KD (1971) Molecular... giant hemoglobin of Tylorrhynchus heterochaetus J Biol Chem 263, 18524–18529 31 Suzuki T, Takagi T & Ohta S (1993) N-terminal amino acid sequences of 440 kDa hemoglobins of the deep-sea tube worms, Lamellibrachia sp.1, Lamellibrachia sp.2 and slender vestimentifera gen sp 1 evolutionary relationship with annelid hemoglobins Zool Sci 10, 141–146 32 Jhiang SM, Garey JR & Riggs AF (1988) Exon-intron organization . structural and functional convergence between circulating and noncirculating intracellular globin and extracellular globin genes in annelids: these genes prob- ably. 2007) doi:10.1111/j.1742-4658.2007.05799.x Globins are the most common type of oxygen-binding protein in annelids. In this paper, we show that circulating intracellular globin (Alvinella