0

burroughes j h bradley d d c brown a b marks r n mackay k friend r h bum p l holmes a b nature 1990 347 539

HBT characterization and modeling for nonlinear microwave circuit design

HBT characterization and modeling for nonlinear microwave circuit design

Cao đẳng - Đại học

... included Symbol Description Cbc internal base-collector capacitance Cbe base-emitter junction capacitance Cex external base-collector capacitance Cjc base-collector junction capacitance Cje base-emitter ... generator chips and ultra high-speed HBT gate arrays For military applications such as radar, communications, electronic warfare and electro-optics, the HBT has become one of the natural candidates ... method can provide an 30 accurate and practical way to extract some VBIC model parameters from the known GP model data sets An improved compact bipolar transistor model for avalanche breakdown...
  • 212
  • 746
  • 0
Báo cáo khoa học: The mouse Muc5b mucin gene is transcriptionally regulated by thyroid transcription factor-1 (TTF-1) and GATA-6 transcription factors pdf

Báo cáo khoa học: The mouse Muc5b mucin gene is transcriptionally regulated by thyroid transcription factor-1 (TTF-1) and GATA-6 transcription factors pdf

Báo cáo khoa học

... CGCACGCGTGGCACAGTGATGTAAATC CGCGAGCTCCCAGGGCCCTTGAGAC CGCACGCGTGGCACAGTGATGTAAATC CGCGAGCTCCAGGGACCCTGCCAG CGCACGCGTGGCACAGTGATGTAAATC CGCGAGCTCTTGCTCCCTGGGGGCCTG CGCACGCGTGGCACAGTGATGTAAATC CGCGAGCTCCCAGGGCCCTTGAGAC ... Mutated T242 GATA ()454 ⁄ )449) GATA CTGCCATGGCCCCTCCCCAAGAGCAAA CGGCAAACACAAGCCAAGGTTGTTGTC CGGCAAACAGTATCGTATGTTGTTGTC TCCAGGGCCCTTGAGACCCTTGGTCATTTC TCCAGGGCCAGTAAGACCAGTAGTCATTTC CCCCTGATCCTTGTAGTGTCTAGT ... kinase (Promega) and [c3< /b> 2P] -dATP Radiolabeled probes were purified by chromatography on a < /b> BioGel P- 6 column (Bio-Rad, Marnes-la-Coquette, France) The commercial GATA probe 5¢-CACTTGATAACAGA AAGTGATAACTCT-3¢...
  • 13
  • 240
  • 0
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc

Báo cáo khoa học

... transferred to nitrocellulose membranes Ure 2p and Ssa 1p protein bands were probed with polyclonal antibody directed against full-length Ure 2p and monoclonal anti-His-tag serum for His-tagged ... mono-linked and loop-linked lysines in Ure 2p and Ssa 1p Peptides containing modified and loop-linked lysine are colored magenta in Ssa 1p (A)< /b> and Ure 2p (B D)< /b> structures Loop-linked residues are colored blue ... dimer are cross-linked, a < /b> 160 kDa product is observed Additional complexes with apparent molecular weight higher than 200 kDa that are immuno stained by both antibodies directed against Ure 2p and...
  • 12
  • 510
  • 0
Giáo án Tiếng anh lớp 6 - Unit 8: OUT AND ABOUT - Lesson 7( C3-4 ) docx

Giáo án Tiếng anh lớp 6 - Unit 8: OUT AND ABOUT - Lesson 7( C3-4 ) docx

Anh ngữ phổ thông

... or turn left V d < /b> Slow down Don’t go straight ahead V e Park here Don’t park here V f Cars and trucks go here V Motorbike go here g Don’t go straight Don’t turn right or left V h < /b> Park here V Don’t ... to part dangerous (adj): nguy hiểm C3< /b> -4 accident (n) : tai n n - First we come to vocabulary discipline (n ): - Elicit to teach vocabulary help(v) : gi p đỡ - Control students to practice vocabulary ... vocabulary warn(v) : c< /b> nh b o fast(adv) nhanh ≠ slow - Check vocabulary by rub out and stop (v) : d< /b> ng l i remember slow down (v) : giảm t c < /b> độ _ - Have Ss look at three road signs in intersection...
  • 4
  • 3,106
  • 5
Giáo án tiếng anh lớp 5 - UNIT 5 SPORTS AND GAMES Section A(4, 5, 6, 7) Period 22 ppsx

Giáo án tiếng anh lớp 5 - UNIT 5 SPORTS AND GAMES Section A(4, 5, 6, 7) Period 22 ppsx

Mầm non - Tiểu học

... 4 -c < /b> Ss read in group Activity3(10’) Read individual Say it right some pairs practice in front of the Guide Ss to say class 1.I play football every day Other listen and remark 2.The girl in the ... S has an apple said: IV Other activity: Do you want to (play badminton)? Play game: Apple pass Then throw it to other, who catch i -Guide Ss to exercises must Answer, then countinues -T remarks ... remark badminton)? White-write: Ss write down the no book B: Sure (It’s an exitting game) - Call some pairs talk in front of the class -Call two Ss write on the board 7.Let’s play T remark One...
  • 6
  • 1,139
  • 1
Giáo án Anh văn lớp 7 : Tên bài dạy : UNIT ONE : BACK TO SCHOOL. Lesson 5: B. Names and addresses (6). pot

Giáo án Anh văn lớp 7 : Tên bài dạy : UNIT ONE : BACK TO SCHOOL. Lesson 5: B. Names and addresses (6). pot

Anh ngữ phổ thông

... T: remarks and gives marks B Presentation: B6 Listen and write How far is it ? Write the four distances *Pre listening - T: introduces the situation of the lesson :Lan and Hoa are talking about ... T: calls on some pairs to practice in front of the class Consolidation; - Ask Ss to base on the information and write a < /b> short passage about their partner EX: My friend is…… He/She lives at……… He/ ... about distances - T: asks Ss to look at the picture in part - Ss call the names of the places - T: draws on the board Lan,s house school post office theater From to distances 1.school Lan,s house...
  • 6
  • 716
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Teratological effect of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD): induction of cleft palate in the ddY and C57BL/6 mouse" pptx

Báo cáo khoa học

... Lamb IV J.< /b> C.< /b> , and McKinney J.< /b> D < /b> Toxic interaction of specific polychlorinated biphenyls and 2,3,7,8-tetrachlorodibenzo-pdioxin: Increased incidence of cleft palate in mice Toxicol Appl Pharmacol ... Birnbaum L S TCDD-induced altered expression of growth factors may have a < /b> role in producing cleft palate and enhancing the incidence of clefts after coadministration of retinoic acid and TCDD ... Toxicol Appl Pharmacol 1990, 106, 418-432 Abbott B D < /b> and Birnbaum L S TCDD alters medial epithelial cell differentiation during palatogenesis Toxicol Appl Pharmacol 1989, 99, 276-286 Abbott B D.< /b> ,...
  • 7
  • 659
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Radiosensitization by 2-benzoyl-3-phenyl-6,7-dichloroquinoxaline 1,4-dioxide under oxia and hypoxia in human colon cancer cells" pdf

Báo cáo khoa học

... reviewed the manuscript HM conceived of the study, and participated in its design and coordination and drafted the manuscript All authors read and approved the final manuscript Acknowledgements This ... oxic conditions predominantly induced relatively non-cytotoxic single-strand breaks DNA single strand breaks or alkali labile sites are by far the largest number of lesions in DNA in general Therefore, ... DCQ and then irradiated After irradiation, cells were re-plated and the colonies were stained with crystal violet and counted 10 days later Each data point was calculated as percent of untreated...
  • 13
  • 229
  • 0
Báo cáo y học:

Báo cáo y học: "Collagen-induced arthritis in C57BL/6 mice is associated with a robust and sustained T-cell response to type II collagen" pot

Báo cáo khoa học

... methods Purification of type II collagen Bovine collagen was purified from articular cartilage, and mouse and chicken collagens were purified from non-articular (sternal) cartilage All collagens were ... have no competing interests uted to the preparation of the manuscript All authors read and approved the final manuscript Acknowledgements This work was funded by the Arthritis Research Campaign, ... prepared by pepsin digestion and salt fractionation according to established procedures [13] Lathyritic rat type II collagen (a < /b> gift from Lars Klareskog, formerly of Uppsala, Sweden) was prepared...
  • 8
  • 372
  • 0
Báo cáo y học:

Báo cáo y học: " Glycine tomentella Hayata inhibits IL-1b and IL-6 production, inhibits MMP-9 activity, and enhances RAW264.7 macrophage clearance of apoptotic cells" docx

Báo cáo khoa học

... detector (PDA) (Schambeck SFD GmbH, Bad Honnef, Germany) [6] Cell culture of RAW264.7 cells RAW264.7 cells were purchased from Bioresource Collection and Research Center (HsinChu, Taiwan) and cultured ... 17:83 Authors’ contributions GJT initiated the concept and design of the study and collected, analyzed, and interpreted the data and prepared the manuscript JHY, DJY, MCC, YFH, and YSS collected ... dry powder was obtained The analytical equipments for the determination of flavonoids and phenolic acids in GTH by high performance liquid chromatography (HPLC) were a < /b> PrimeLine™ Gradient Model...
  • 9
  • 217
  • 0
Bài giảng tham khảo thao giảng Anh 6 Unit 16 Man and the environment (7)

Bài giảng tham khảo thao giảng Anh 6 Unit 16 Man and the environment (7)

Tiếng anh

... How much milk his cows produce? How much milk his cows produce? buffalo They plow the paddy fields and pull a < /b> cart He has a < /b> few cows They produce a < /b> little How many eggs his chicken produce? How ... rice does Mr Hai produce? How much rice does lot of produce? fields and he produces a < /b> Mr Hairice Near his house, he he produce field vegetables? a < /b> few has a < /b> small and he grows Does he produce any ... How has some chickens They produce a < /b> lot milk Hemany eggs his chicken produce? of eggs He also has a < /b> dog and two cats What does Mr Hai do? What does Mr Hai do? TOM JERRY He produces a < /b> lot of rice...
  • 22
  • 389
  • 0
Bài giảng điện tử tham khảo thao giảng, thi GV anh 6 Unit 13 Activities and the seasons (7)

Bài giảng điện tử tham khảo thao giảng, thi GV anh 6 Unit 13 Activities and the seasons (7)

Tiếng anh

... Winter Watch television Fall Go to the movies 2b Make dialogues with a < /b> partner: What you in the spring ? I always ride my bike What you do? I usually go fishing Minh Ba 2c.< /b> Write about you Begin ... with: In the spring, I ……… Example: In the spring , I usually go fishing In the summer, I often play soccer In the winter, I never go camping In the fall , I sometimes have a < /b> picnic LUCKY FLOWERS ... 14 BACK B T ĐẦU Go to the zoo Spring Go swimming Summer Listen to music Play sports Ride a < /b> bike Go sailing Activities and seasons Play games Go camping Go fishing Go jogging Go to the park Winter...
  • 29
  • 294
  • 0
The KMP (peasant movement of the philippines)  movement generation, activity, and continuity in philippine society 6  7

The KMP (peasant movement of the philippines) movement generation, activity, and continuity in philippine society 6 7

Thạc sĩ - Cao học

... Inc and ANCA Corporation in Ilagan, Isabela in 1990 319 More than a < /b> decade has passed and no news of land occupation has been heard or any particular plan by the KMP has been drawn The primary ... its provincial chapters – militarization in Bataan, peasant women issues, San Roque dam issue in Pangasinan, PDDP project in Pampanga and Nueva Ecija, SACOBIA project in Tarlac, land grabbing in ... exacerbate or alleviate them The second embarks on how oppositional peasant politics on a < /b> global scale challenges larger and broader power formations and structures to advance local and national...
  • 86
  • 301
  • 0
2295 irregular verbs  groups 6 7 and 8

2295 irregular verbs groups 6 7 and 8

Anh ngữ cho trẻ em

... verbs in simple past and past participle end in “ound” Bind – bound - bound Find – found - found Grind – ground - ground Wind – wound - wound Group The verbs in simple past and past participle ... simple past and past participle end in “old” Sell – sold -sold Tell – told - told Group The verbs in simple past and past participle end in “old” Sell – sold -sold Tell – told - told Group The ... Lend – lent - lent Bend – bent - bent Spent – spent - spent Send – sent - sent Group Substitute the d< /b> for a < /b> “t” and you get the verbs in simple past and past participle Group The verbs in...
  • 6
  • 167
  • 0
Marketing Quốc tế  Bài giảng + Case study chương 4,5,6,7,8

Marketing Quốc tế Bài giảng + Case study chương 4,5,6,7,8

Internet Marketing

... CH N NHÀ PH N PHỐI VỚI NHÀ PH N PHỐI Đ C < /b> L A < /b> CH N H< /b> NH THÀNH D< /b> B O B N H< /b> NG THƯƠNG L NG K HOẠCH D< /b> TRỮ THƯƠNG L NG HP ĐỒNG B N H< /b> NG VỚI NHÀ PH N PHỐI TH C < /b> HI N CHƯƠNG TRÌNH X C < /b> ĐỊNH NHÀ PH N PHỐI ... Base cost per unit Export packing, labeling, marking Product inspections charges Profit or mark-up Inland freight to Unloading at port/air port Terminal charges Export duty (if any) Loading charges ... HU N LUY N VỀ S N PHẨM VÀ B N H< /b> NG CHO L C < /b> L NG B N H< /b> NG C< /b> A < /b> NHÀ PH N PHỐI 10 PHÁT TRI N K HOẠCH B N H< /b> NG T C < /b> NGHI P VỚI BAN QU N TRỊ B N H< /b> NG C< /b> A < /b> NHÀ PH N PHỐI NHỮNG YẾU TỐ CH N NHÀ PH N PHỐI,...
  • 78
  • 2,203
  • 6
English for Tourism and Hospitality 6

English for Tourism and Hospitality 6

TOEFL - IELTS - TOEIC

... EXERCISES Key vocabulary Look up the meaning and pronunciation of these words in your dictionary appetisers chillies ginger ready boiled crispy order sauce coconut dishes popular sounds chicken ... garlic quite hot steamed Language Practice – Describing dishes Match the start of the sentence with the correct ending Practise saying them with your friends The Crispy Fish is very popular The ... tofu and garlic Language Practice – writing sentences Below are some key words Write sentences then say them out loud Example: Garlic / Chicken / good The Garlic Chicken is quite good rather / busy...
  • 2
  • 912
  • 29
English for Tourism and Hospitality 6

English for Tourism and Hospitality 6

TOEFL - IELTS - TOEIC

... a < /b> plate of steamed vegetables with our meal Jean: Fine And would you like boiled or coconut rice with that? Mona: Boiled please Jack: I'll have coconut rice please Jean: Fine Will there be anything ... n i c< /b> u: 'Thank sa lot' 'Thank sa lot!' C< /b> c < /b> b n c< /b> l không nghe thấy kh c < /b> biệt, người nghe b n ch n nh n C< /b> c < /b> b n thử ghi âm l i c< /b> u n i mình, b n c< /b> l ng c < /b> nhi n thấy c< /b> ch phát âm l i r r ng ... you have Australian? Jean: Yes, we Jack: I'll have Australian thanks Mona: Just a < /b> bottle of water for me, thank you Jean: Certainly Ỳour beer, Sir… and water for you, Madam Now, are you ready...
  • 7
  • 417
  • 4
Quản trị nhân lực - Chương 6,7,8,9

Quản trị nhân lực - Chương 6,7,8,9

Quản trị kinh doanh

... C< /b> c < /b> phương ph p đánh giá th c < /b> công vi c < /b> Phương ph p thang đo đánh giá đồ hoạ Phương ph p danh m c < /b> kiểm tra Phương ph p ghi ch p ki n quan trọng Phương ph p đánh giá thang đo d< /b> a < /b> h< /b> nh vi C< /b> c < /b> ... h< /b> nh vi không tích c< /b> c < /b> 48 Phương ph p đánh giá thang đo d< /b> a < /b> h< /b> nh vi Đây phương ph p k t h< /b> p phương ph p thang đo đánh giá đồ hoạ phương ph p ghi ch p ki n quan trọng C< /b> c < /b> thang đánh giá (b ng điểm) ... ch c,< /b> c< /b> ng t c < /b> đào tạo phát tri n ngu n nh n l c < /b> c n th c < /b> cách c< /b> k hoạch n c < /b> ta c< /b> phương ph p đào tạo ứng d< /b> ng 27 Chương ch n Đánh giá l c < /b> th c < /b> công vi c < /b> nh n vi n 28 Khái niệm đánh giá c< /b> ng...
  • 57
  • 825
  • 1
Tỷ lệ khò khè ở học sinh 6-7 tuổi

Tỷ lệ khò khè ở học sinh 6-7 tuổi

Y khoa - Dược

... wheezing and characteristic features of physiciandiagnosed asthma among 6-7 year-old schoolchildren in Tien Giang province Method: Cross-sectional survey Results: 940 schoolchildren joined in ... sprayed medicine when having asthma attacks Conclusion: The prevalence of wheezing in the last 12 months among 6–7 yearold schoolchildren in Tien Giang was at moderate – high level and the prevalence ... were 29% while mean days of missing school due to asthma came to 6.8 days The most common places of choice for treatment asthma attacks were in hospital or health center (57%) and clinical cabinet...
  • 21
  • 475
  • 1

Xem thêm

Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008