a tree sequence alignmentbased
Báo cáo khoa học: "A Tree Sequence Alignment-based Tree-to-Tree Translation Model" potx
... Forest-to-String Statistical Translation Rules. ACL-07. 704-711. Daniel Marcu, W. Wang, A. Echihabi and K. Knight. 2006. SPMT: Statistical Machine Translation with Syntactified Target Language Phrases. ... decoding algorithm. It translates each span ite-ratively from small one to large one (lines 1-2). This strategy can guarantee that when translating the current span, all spans smaller than the ... current one have already been translated before if they are translatable (line 7). When translating a span, if the usable rule is an initial rule, then the tree sequence on the target side of...
- 9
- 303
- 0
Báo cáo khoa học: "A non-contiguous Tree Sequence Alignment-based Model for Statistical Machine Translation" pptx
... statistical machine translation with syn-tactified target language phrases. EMNLP-06. 44-52. Franz J. Och and Hermann Ney. 2004. The alignment template approach to statistical machine translation. ... Zhang, Hongfei Jiang, AiTi Aw, Haizhou Li, Chew Lim Tan and Sheng Li. 200 8a. A tree sequence alignment-based tree- to -tree translation model. ACL-08. 559-567. Min Zhang, Hongfei Jiang, Haizhou ... ACL-07. 704-711. Daniel Marcu and William Wong. 2002. A phrase-based, joint probability model for statistical machine translation. EMNLP-02, 133-139 Daniel Marcu, W. Wang, A. Echihabi and...
- 9
- 281
- 0
Tài liệu Module 6: Using XPath to Navigate a Tree of Nodes ppt
... participants additional ideas about the uses of XPath. To understand XPath, participants will need good verbal and visual examples, so be ready to diagram XPath examples if required to clarify ... XPath expressions from a list box control. iv Module 6: Using XPath to Navigate a Tree of Nodes Materials and Preparation This section provides the materials and preparation tasks that ... What Is XPath? 2 Lesson: Using XPath 11 Lesson: The Range of Application of XPath 21 Lab 6: Using XPath to Navigate and Select Data 27 Review 37 Module 6: Using XPath to Navigate a Tree...
- 46
- 544
- 0
Báo cáo Y học: Defective translocation of a signal sequence mutant in a prlA4 suppressor strain of Escherichia coli doc
... of thesignal sequence. Tetracycline-resistant prlA+and prlA4Table 1. Bacterial strains and plasmids used in this study. Camrand Amprindicate resistance to chloramphenicol and ampicillin, ... the Imagequant software(Molecular Dynamics) after scanning of the autoradiogram.In vitrotranscription, translation, targetingand cross-linking analysisTo generate truncated mRNA, plasmids ... proposed that prlA mutations cause a generalrelaxation of the export apparatus [21,24] rather than a specific change that results in bypassing a proofreadingmechanism of the Sec machinery [25].The...
- 9
- 493
- 0
Báo cáo khoa học: "MIX Is Not a Tree-Adjoining Language" doc
... is a terminating rule, then a tree with a single node labeled by A( w1, w2)isaderivation tree for A( w1, w2).S(aa a aa a, #¯aa a aaa)D(aa a aa a, ¯aa a aaa)F(aa a a, a aaa) A( a, a) ... E (a a a, a aa)D (a a, ¯aa)F (a a, ¯aa) A( a, a) E( a, a) D(ε, ε) A ( a, a) D(ε, ε) A ( a, a) D (a a, ¯aa)F (a a, ¯aa) A( a, a) E( a, a) D(ε, ε) A ( a, a) D(ε, ε)C(ε, #)Figure 1: An ... derivation tree for w is a derivation tree for some S(w1, w2) such that w1w2= w.Example 1 (continued). Figure 1 shows a derivation tree for aa a ¯aa a# ¯aa a aaa.The follo wing lemma should...
- 9
- 374
- 0
Báo cáo khoa học: "A Tree Transducer Model for Synchronous Tree-Adjoining Grammars" pdf
... Computational Linguistics A Tree Transducer Model for Synchronous Tree- Adjoining GrammarsAndreas MalettiUniversitat Rovira i VirgiliAvinguda de Catalunya 25, 43002 Tarragona, Spain.andreas.maletti@urv.catAbstract A ... we assumethat all adjunctions are mandatory; i.e., if an aux-iliary tree can be adjoined, then we need to makean adjunction. Thus, a derivation starting from aninitial tree to a derived tree ... auxiliary tree by a special marker. Traditionally, the root label A ofan auxiliary tree is replaced by A ∅once adjoined.Since we assume that there are no auxiliary treeswith such a root label,...
- 10
- 294
- 0
Báo cáo khoa học: "Bayesian Learning of a Tree Substitution Grammar" potx
... able to take direct advantage of manually an-notated corpora like the Penn Treebank, which arenot marked for derivations and thus assume a stan-dard CFG. Since different TSG derivations canproduce ... foundthat the use of larger subtrees did correlate withaccuracy; however, the low overall accuracy (andthe fact that there are so many of these large sub-trees available in the grammar) suggests ... EMNLP.Thomas S. Ferguson. 1973. A Bayesian analysis ofsome nonparametric problems. Annals of Mathe-matical Statistics, 1(2):209–230.Sharon Goldwater, Thomas L. Griffiths, and MarkJohnson. 2009. A Bayesian...
- 4
- 289
- 0
The boy climbed a tree pot
... climbed a tree The boy climbed a tree. 3. Tại sao lại câu trên lại dịch như vậy? Các bạn thấy từ "boy" trong tiếng Anh là có ngh a là "cậu bé", nhưng khi đứng sau mạo ... người ta gọi là mạo từ xác định. Mạo từ thường đi trước danh từ và nếu mạo từ xác định (the) đi trước danh từ thì nó làm cho danh từ đó đã xác định (người nói và người nghe đã biết danh từ ... "climbed" là dạng quá khứ c a động từ climb (leo trèo). Hay có cách nói khác là động từ climb ở câu này được chia ở thời (thì) quá khứ đơn (simple past tense). Động từ được chia ở thì quá khứ đơn diễn...
- 5
- 374
- 0
Báo cáo khoa học: Functional importance of a conserved sequence motif in FhaC, a prototypic member of the TpsB/Omp85 superfamily ppt
... (5¢-GACGAGTACACGGTGGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TCCTGAGGTTGTATCCG GCCACCGTGT ACTCGTC-3¢);Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAGACGTC-3¢) and Y452ALo (5¢-GACGTCCTGAGGTTGGCTCCGGCCACCGTGT-3¢); RA+YAUp (5¢-ACACGGTGGCCGGAGCCAACCTCAGGACGTC-3¢) ... density map and are not included in the finalmodel. Structural data are available in the Protein DataBank database under the accession number 3NJT.Channel analysisThe planar lipid bilayer recordings ... the same buffer as above. Equal amounts of sam-ples were separated by SDS ⁄ PAGE and analysed by westernblot with an anti-FhaC serum. This antibody was raised inrats against the periplasmic...
- 11
- 396
- 0
Hacking from a network: SYN flood and TCP Sequence number prediction attacks
... will disable a service until the attacker decides to:go away and SYN no more.This was an elegant attack, for a small number of packets an attacker could freeze a particular service on a host ... have a particular signature, in fact, you could even say it might be somewhat predictable!21IDIC - SANS GIAC LevelTwo ©2000, 200121Diary of an AttackThe IP spoofing attack started at about ... so that the sender appears to be an unreachable host?– We need a real routable to, unreachable host, such as a PC that gets turned off at night and so forth.– We need to assemble the packet...
- 31
- 491
- 0
Nghiên cứu chỉ thị phân tử SSR (simple sequence repeats) trong chọn giống lúa
... RM2 7 acgtgtcaccgcttcctc atgtccgggatctcatcg 2 RM5 1 tgcaacttctagctgctcga gcatccgatcttgatggg 3 RM16 3 cgctagggcagcatctaaaa aacacagcaggtacgcgc 4 RM50 6 actgtaccggtcgaagacg aaattccacgtcagcctcc ... gtgaatggtcaagtgacttaggtggc acacaacatgttccctccatgc 6 RM102 1 aactttccaccaccaccgcgg agcagcaagccagcaagcg 7 RM104 1 cttccaattcaggccggctggc cgccagctgaccatgcatgc 8 RM164 5 tcttgcccgtcactgcagatatcc ... RM206 11 cccatgcgtttaactattct cgttccatcgatccgtatgg 13 RM208 2 tctgcaagccttgtcgatg taagtcgatcattgtgtggacc 14 RM218 3 ttggtcaaaccaaggtccttc gacatacattctacccccgg 15 RM234 7 acaaggccgagaggattccg gctctccggtggctccgattgg...
- 120
- 1,536
- 4
Nghiên cứu chỉ thị phân tử SSR (simple sequence repeats) trong chọn giống lúa
... nam 12 Mà cha Javanica Viện Khoa học KTNN Việt nam 13 Tan do Javanica Viện Khoa học KTNN Việt nam 14 Chiêm Phú xuyên Javanica Viện Khoa học KTNN Việt nam 15 Khẩu nua tẩu Javanica ... khoa hc Nụng nghip 21 (2003) cho rằng, mức độ thể hiện u thế lai ở l a theo thứ tự Indica/ Japonica > Indica/ Javanica > Japonica/ Javanica > Indica/ Indica > Japonica/ Japonica. ... đặc điểm c a l a Japonica. Gây tạo l a lai Indica/ Javanica có thể đóng vai trò tơng tự trong việc cải tiến chất lợng hạt cũng nh tăng năng suất l a Indica. L a lai Indica/ Japonica có tiềm...
- 120
- 1,252
- 3
- are stimulated by extracellular matrix proteins such as type i collagen previous studies have demonstrated the involvement of a dggryy sequence located within the a1 chain cterminal telopeptide in type i collageninduced pmn activation
- getting a sequence value from oracle
- statistical sentence generation introducing a dependency spanning tree algorithm
- an aspect of tree adjoining grammars tag and a comparison of some formal properties of tags
- a hybrid convolution tree kernel
- a noncontiguous tree sequence alignmentbased model
- a joint sequence translation model
- a tree transducer model
- qualifications of a tree surgeon
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008